Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU077121

Sigma-Aldrich

MISSION® esiRNA

targeting human OCLN

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización

Seleccione un Tamaño

20 μG
MXP 5,935.00
50 μG
MXP 10,600.00

MXP 5,935.00


Check Cart for Availability


Seleccione un Tamaño

Cambiar Vistas
20 μG
MXP 5,935.00
50 μG
MXP 10,600.00

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

MXP 5,935.00


Check Cart for Availability

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

AAGGGAAGAGCAGGAAGGTCAAAGAGAACAGAGCAAGATCACTATGAGACAGACTACACAACTGGCGGCGAGTCCTGTGATGAGCTGGAGGAGGACTGGATCAGGGAATATCCACCTATCACTTCAGATCAACAAAGACAACTGTACAAGAGGAATTTTGACACTGGCCTACAGGAATACAAGAGCTTACAATCAGAACTTGATGAGATCAATAAAGAACTCTCCCGTTTGGATAAAGAATTGGATGACTATAGAGAAGAAAGTGAAGAGTACATGGCTGCTGCTGATGAATACAATAGACTGAAGCAAGTGAAGGGATCTGCAGATTACAAAAGTAAGAAGAATCATTGCAAGCAGTTAAAGAGCAAATTGTCACACATCAAGAAGATGGTTGGAGACTATGATAGACAGAAAACATAGAAGGCTGATGCCAAGTTGTTTGA

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

James Keaney et al.
Science advances, 1(8), e1500472-e1500472 (2015-10-23)
The blood-brain barrier (BBB) is essential for maintaining brain homeostasis and protecting neural tissue from damaging blood-borne agents. The barrier is characterized by endothelial tight junctions that limit passive paracellular diffusion of polar solutes and macromolecules from blood to brain.
Kentaro Jingushi et al.
International journal of oncology, 51(1), 289-297 (2017-05-24)
Renal cell carcinoma (RCC) is the most common neoplasm of the adult kidney, and clear cell RCC (ccRCC) represents its most common histological subtype. Although several studies have reported high expression of miR-122 in ccRCC, its physiological role remains unclear.
Hiroshi Tokuo et al.
Molecular biology of the cell, 24(18), 2820-2833 (2013-07-19)
Cooperation between cadherins and the actin cytoskeleton controls the formation and maintenance of cell-cell adhesions in epithelia. We find that the molecular motor protein myosin-1c (Myo1c) regulates the dynamic stability of E-cadherin-based cell-cell contacts. In Myo1c-depleted Madin-Darby canine kidney cells
Thomas Volksdorf et al.
The American journal of pathology, 187(6), 1301-1312 (2017-04-17)
Tight junction (TJ) proteins are known to be involved in proliferation and differentiation. These processes are essential for normal skin wound healing. Here, we investigated the TJ proteins claudin-1 and occludin in ex vivo skin wound healing models and tissue samples
Dalia S Elhelw et al.
Archives of virology, 162(11), 3283-3291 (2017-06-24)
Occludin (OCLN) is an essential factor for HCV entry through interacting with other surface receptors. The aim of this study was to investigate the epigenetic regulation of Occludin expression and to study its impact on viral infectivity. microRNAs expression was

Questions

Reviews

No rating value

Active Filters

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico