Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU076241

Sigma-Aldrich

MISSION® esiRNA

targeting human ERG

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CGGGGAAGAGATCCAAAGACTCTTGGGAGGGAGTTACTGAAGTCTTACTACAGAAATGAGGAGGATGCTAAAAATGTCACGAATATGGACATATCATCTGTGGACTGACCTTGTAAAAGACAGTGTATGTAGAAGCATGAAGTCTTAAGGACAAAGTGCCAAAGAAAGTGGTCTTAAGAAATGTATAAACTTTAGAGTAGAGTTTGGAATCCCACTAATGCAAACTGGGATGAAACTAAAGCAATAGAAACAACACAGTTTTGACCTAACATACCGTTTATAATGCCATTTTAAGGAAAACTACCTGTATTTAAAAATAGAAACATATCAAAAACAAGAGAAAAGACACGAGAGAGACTGTGGCCCATCAACAGACGTTGATATGCAACTGCATGGCATGTGCTGTTTTGGTTGAAATCAAATACATTCCGTTTGATGGACAGCT

Ensembl | human accession no.

ENSG00000157554

NCBI accession no.

NM_182918

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... ERG(2078) , ERG(2078)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Rohit Bose et al.
Nature, 546(7660), 671-675 (2017-06-15)
Half of all prostate cancers are caused by the TMPRSS2-ERG gene-fusion, which enables androgens to drive expression of the normally silent E26 transformation-specific (ETS) transcription factor ERG in prostate cells. Recent genomic landscape studies of such cancers have reported recurrent
Abdullah A Assiri et al.
Cancer genomics & proteomics, 16(6), 433-442 (2019-10-30)
hERG potassium channels enhance tumor invasiveness and breast cancer proliferation. MicroRNA (miRNA) dysregulation during cancer controls gene regulation. The objective of this study was to identify miRNAs that regulate hERG expression in breast cancer. Putative miRNAs targeting hERG were identified
J Kim et al.
Oncogene, 33(44), 5183-5192 (2013-11-05)
Chromosomal translocations that juxtapose the androgen-sensitive transmembrane protease, serine 2 (TMPRSS2) gene promoter to the oncogenic ETS-family transcription factor ERG result in excessive ERG overexpression in approximately 50% of prostate cancer (PCa) patients. Although numerous studies have investigated ERG-downstream genes
Jung-Sun Kim et al.
Endocrinology, 155(9), 3262-3273 (2014-06-14)
A number of preclinical studies have shown that the activation of the vitamin D receptor (VDR) reduces prostate cancer (PCa) cell and tumor growth. The majority of human PCas express a transmembrane protease serine 2 (TMPRSS2):erythroblast transformation-specific (ETS) fusion gene
Feng Zhou et al.
Oncogene, 38(22), 4397-4411 (2019-02-06)
The aberrant activation of the ERG oncogenic pathway due to the TMPRSS2-ERG gene fusion is the major event that contributes to prostate cancer (PCa) development. However, the critical downstream effectors that can be therapeutically targeted remain to be identified. In
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico