Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU024581

Sigma-Aldrich

MISSION® esiRNA

targeting human PDCD6IP

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización

Seleccione un Tamaño

20 μG
MXP 5,935.00
50 μG
MXP 10,600.00

MXP 5,935.00


Fecha estimada de envío13 de mayo de 2025



Seleccione un Tamaño

Cambiar Vistas
20 μG
MXP 5,935.00
50 μG
MXP 10,600.00

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

MXP 5,935.00


Fecha estimada de envío13 de mayo de 2025


descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GCAAAGCCACACTTGTGAAATCTACCCCGGTCAATGTACCCATCAGTCAGAAATTTACTGATCTGTTTGAGAAGATGGTTCCCGTGTCAGTACAGCAGTCTTTGGCTGCCTATAATCAGAGGAAAGCCGATTTGGTTAACAGATCAATTGCTCAGATGAGAGAAGCCACCACTTTGGCAAATGGGGTGCTAGCTTCCCTTAATCTTCCAGCAGCAATTGAAGATGTGTCTGGAGACACTGTACCTCAGTCTATATTGACTAAATCCAGATCTGTGATTGAACAGGGAGGCATCCAGACTGTTGATCAGTTGATTAAAGAACTGCCTGAATTACTGCAACGAAATAGAGAAATCCTAGATGAGTCATTAAGGTTGTTGGATGAAGAAGAAGCAACCGATAATGATTTAAGAGCAAAATTTAAGGAACGTTGGCAAAGGACACCATCCAATGAACTGTATAAGCCTTTAAGAGCAGAGGGAACCAACTTCA

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Julianne V de Carvalho et al.
PloS one, 9(11), e113691-e113691 (2014-11-26)
Nef is an HIV-1 accessory protein that promotes viral replication and pathogenesis. A key function of Nef is to ensure sustained depletion of CD4 and MHC-I molecules in infected cells by inducing targeting of these proteins to multivesicular bodies (MVBs)
Li Zhong et al.
Signal transduction and targeted therapy, 6(1), 59-59 (2021-02-12)
It remains unknown for decades how some of the therapeutic fusion proteins positive in a small percentage of cancer cells account for patient outcome. Here, we report that osteosarcoma Rab22a-NeoF1 fusion protein, together with its binding partner PYK2, is sorted
Allaura S Cone et al.
BMC molecular and cell biology, 21(1), 58-58 (2020-08-01)
Endosomal trafficking and amyloidogenic cleavage of amyloid precursor protein (APP) is believed to play a role in the neurodegeneration observed in Alzheimer's disease (AD). Recent evidence has suggested that packaging and secretion of APP and its amyloidogenic cleaved products into
Brian A Davies et al.
Molecular biology of the cell, 31(22), 2463-2474 (2020-08-28)
Intercellular communication is critical for organismal homeostasis, and defects can contribute to human disease states. Polarized epithelial cells execute distinct signaling agendas via apical and basolateral surfaces to communicate with different cell types. Small extracellular vesicles (sEVs), including exosomes and

Questions

Reviews

No rating value

Active Filters

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico