Saltar al contenido
Merck

EHU008271

Sigma-Aldrich

MISSION® esiRNA

targeting human KDM6B

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACCCGAAGAACCATCACATCATCAAGTTTGGCACCAACATCGACTTGTCTGATGCTAAGCGGTGGAAGCCCCAGCTGCAGGAGCTGCTGAAGCTGCCCGCCTTCATGCGGGTAACATCCACGGGCAACATGCTGAGCCACGTGGGCCACACCATCCTGGGCATGAACACGGTGCAGCTGTACATGAAGGTGCCCGGCAGCCGAACGCCAGGCCACCAGGAGAATAACAACTTCTGCTCCGTCAACATCAACATTGGCCCAGGCGACTGCGAGTGGTTCGCGGTGCACGAGCACTACTGGGAGACCATCAGCGCTTTCTGTGATCGGCACGGCGTGGACTACTTGACGGGTTCCTGGTGGCCAATCCTGGATGATCTCTATGCATCCAATATTCCTGTGTACCGCTTCGTGCAGCGACCCGGAGACCTCGTGTGGATTAATGCGGGGACTGTGCACTGGGTGCAGGCCACCGGCTGGTGCAACAACATTGCCTGGAACGTGGGGCCCCTCACCGCCTATCAGTACCAGCTGGC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Wanwan Jia et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 32(7), 4031-4042 (2018-02-27)
Rheumatoid arthritis (RA) is an immune-mediated disease with the characteristics of progressive joint destruction, deformity, and disability. Epigenetic changes have been implicated in the development of some autoimmune disorders, resulting in an alteration of gene transcription. Here, we investigated how
Hiroyuki Imuta et al.
Heart and vessels, 35(12), 1746-1754 (2020-07-18)
Macrophages play a crucial role in the development of atherosclerosis. To explore the mechanism by which macrophages attain a proinflammatory phenotype for a sustained period, we stimulated macrophages with lipopolysaccharide (LPS) and interferon-γ (IFN-γ) and measured the interleukin-1β (IL-1β) expression.
Jianchun Wu et al.
Oncology reports, 34(1), 455-460 (2015-05-23)
Mammary stem cells (MSCs) are the progenitor population for human breast epithelia. MSCs give rise during mammary gland development to estrogen receptor (ER)-negative basal cells and the ER- luminal progenitor (LP) population which maintains ER+ and ER- luminal cells. The

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico