Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EMU015011

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Akt1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AACGATGGCACCTTTATTGGCTACAAGGAACGGCCTCAGGATGTGGATCAGCGAGAGTCCCCACTCAACAACTTCTCAGTGGCACAATGCCAGCTGATGAAGACAGAGCGGCCAAGGCCCAACACCTTTATCATCCGCTGCCTGCAGTGGACCACAGTCATTGAGCGCACCTTCCATGTGGAAACGCCTGAGGAGCGGGAAGAATGGGCCACCGCCATTCAGACTGTGGCCGATGGACTCAAGAGGCAGGAAGAAGAGACGATGGACTTCCGATCAGGCTCACCCAGTGACAACTCAGGGGCTGAAGAGATGGAGGTGTCCCTGGCCAAGCCCAAGCACCGTGTGACCATGAACGAGTTTGAGTACCTGAAACTACTGGGCAAGGGCACCTTTGGGAAAGTGATTCTGGTGAAAGAGAAGGCCACAGG

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Toni M Brand et al.
Cancer research, 74(18), 5152-5164 (2014-08-20)
The EGFR antibody cetuximab is used to treat numerous cancers, but intrinsic and acquired resistance to this agent is a common clinical outcome. In this study, we show that overexpression of the oncogenic receptor tyrosine kinase AXL is sufficient to
Lucía Barbier-Torres et al.
Oncotarget, 6(4), 2509-2523 (2015-02-05)
The current view of cancer progression highlights that cancer cells must undergo through a post-translational regulation and metabolic reprogramming to progress in an unfriendly environment. In here, the importance of neddylation modification in liver cancer was investigated. We found that
Tsung-Chieh Lin et al.
The Journal of pathology, 237(1), 50-61 (2015-05-01)
Ghrelin is an appetite-regulating molecule that promotes growth hormone (GH) release and food intake through growth hormone secretagogue receptor (GHS-R). Recently, high ghrelin levels have been detected in various types of human cancer. Ghrelin expression is observed in proximal and
Xiaozhan Zhang et al.
Infection, genetics and evolution : journal of molecular epidemiology and evolutionary genetics in infectious diseases, 34, 415-422 (2015-06-13)
Viral infections activate many host signaling pathways, including the phosphatidylinositol 3-kinase (PI3K)/Akt pathway, which has recently attracted considerable interest due to its central role in modulating virus replication. This study demonstrated that the sero-type 3 reovirus strain Masked Palm Civet/China/2004
Yuko Ibuki et al.
Carcinogenesis, 35(6), 1228-1237 (2014-01-09)
Post-translational modifications in histones have been associated with cancer. Although cigarette sidestream smoke (CSS) as well as mainstream smoke are carcinogens, the relationship between carcinogenicity and histone modifications has not yet been clarified. Here, we demonstrated that CSS induced phosphorylation

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service