Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EMU010641

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Map2k1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCCAGCATCTGAGCCTTTAGGAAGCAGCAAAGAGGAATTCTCTGCCCAGTGGCATGCCATGTTGCTTTCAGGCCTCTCCCATGCTTGTCTATGTTCAGACGTGCATCTCATCTGTGACAAAGGATGAAGAACACAGCATGTGCCAAATTGTACTTGTGTCATTTTTAATATCATTGTCTTTATCACTATGGTTACTCCCCTAAGTGGATTGGCTTTGTGCTTGGGGCTATTTGTCTGTTCATCAAACACATGCCAGGCTGAACTACAGTGAAACCCTAGTGACCTGGGTGGTCGTTCTTACTGATGTTTGCACTGCTGTTCATCGTGACTCACTAGCTGGCTGCCTGTATTGTCAGGATTCTCGGACCTTGGTACTTCACTCTTGCTGGTGACCTCTCAGTCTGAGAGGGAGCCTTGTG

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Biochem/physiol Actions

Map2k1 (dual specificity mitogen-activated protein kinase kinase 1) is a serine threonine kinase and is required for ERK (extracellular-signal-regulated kinase) activation. Activation of ERK is associated with production of IL-10 (interleukin 10) and IL-12. Absence of the Map2k1 gene results in embryonic lethality. Map2k1 is responsible for the stimulation of epidermal proliferation, regulating cell migration in fibroblasts. Deficiency of Map2k1 protein causes lupus-like syndrome.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Jui-Tai Chen et al.
Toxicology, 339, 40-50 (2015-12-15)
Glutamate can activate NMDA receptor (NMDAR) and subsequently induces excitotoxic neuron loss. However, roles of NMDARs in the blood-brain barrier (BBB) are little known. This study used a mouse cerebrovascular endothelial cell (MCEC) model to evaluate the effects of NMDAR
Mohamad Bouhamdan et al.
Cellular signalling, 27(10), 2068-2076 (2015-07-26)
The mitogen activated protein kinases ERK1/2 play an important role in response to toll like receptor (TLR) activation and cytokine production, including IL-10 and IL-12. Here, we examined the role of MEK1 in ERK1/2 activation in response to TLR4 agonist
Elisa Zienert et al.
Cancer letters, 364(1), 17-24 (2015-04-29)
Numerous factors determine the current poor prognosis of pancreatic ductal adenocarcinoma (PDAC). One of the greatest challenges to overcome is treatment resistance. Among a large repertoire of intrinsic resistance mechanisms, integrin-mediated cell adhesion to extracellular matrix (ECM) has been identified
Li Ren Kong et al.
Molecular cancer therapeutics, 14(7), 1750-1760 (2015-05-06)
Genomic analyses of squamous cell carcinoma (SCC) have yet to yield significant strategies against pathway activation to improve treatment. Platinum-based chemotherapy remains the mainstay of treatment for SCC of different histotypes either as a single-agent or alongside other chemotherapeutic drugs

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service