설명
Powered by Eupheria Biotech
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
GCGCTTTGTACCGTCCTCCGGTCCACGCTCGCAGTCTCTCCGCCACCATGCCTATGTTCATCGTGAACACCAATGTTCCCCGCGCCTCCGTGCCAGAGGGGTTTCTGTCGGAGCTCACCCAGCAGCTGGCGCAGGCCACCGGCAAGCCCGCACAGTACATCGCAGTGCACGTGGTCCCGGACCAGCTCATGACTTTTAGCGGCACGAACGATCCCTGCGCCCTCTGCAGCCTGCACAGCATCGGCAAGATCGGTGGTGCCCAGAACCGCAACTACAGTAAGCTGCTGTGTGGCCTGCTGTCCGATCGCCTGCACATCAGCCCGGACCGGGTCTACATCAACTATTACGACATGAACGCTGCCAACGTGGGCTGGAACGGTTCCACCTTCGCTTGAGTCCTGGCCCCACTTACCTGCACCGCTGTTCTTTGAGCCTCGCTCCACGTAGTGTTCTGTGTTTATCCACCGGTAGCGATGCCCACCTTC
Ensembl | 마우스 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
mouse ... MIF(17319) , Mif(17319)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Jie Zeng et al.
Molecular medicine reports, 13(1), 174-180 (2015-11-10)
Macrophage migration inhibitory factor (MIF) is closely associated with tumorigenesis. The present study aimed to investigate the effects of MIF on the proliferation, migration and colony formation of oral squamous cell carcinoma (OSCC), and to quantify the protein expression levels
Y Liu et al.
Cell death & disease, 5, e1361-e1361 (2014-08-08)
Osteosarcoma is a common primary bone tumor in children and adolescents. The drug resistance of osteosarcoma leads to high lethality. Macrophage migration inhibitory factor (MIF) is an inflammation-related cytokine implicated in the chemoresistance of breast cancer. In this study, we
Yeyou Liang et al.
Metabolism: clinical and experimental, 64(12), 1682-1693 (2015-10-13)
Evidence shows that both macrophage migration inhibitory factor (MIF) and GLUT4 glucose transporter are involved in diabetic cardiomyopathy (DCM), but it remains largely unknown whether and how MIF regulates GLUT4 expression in cardiomyocytes. The present study aims to investigate the
Eun Ju Jeong et al.
Nanoscale, 7(47), 20095-20104 (2015-11-17)
Although chitosan and its derivatives have been frequently utilized as delivery vehicles for small interfering RNA (siRNA), it is challenging to improve the gene silencing efficiency of chitosan-based nanoparticles. In this study, we hypothesized that controlling the spacer arm length
Bruno Costa-Silva et al.
Nature cell biology, 17(6), 816-826 (2015-05-20)
Pancreatic ductal adenocarcinomas (PDACs) are highly metastatic with poor prognosis, mainly due to delayed detection. We hypothesized that intercellular communication is critical for metastatic progression. Here, we show that PDAC-derived exosomes induce liver pre-metastatic niche formation in naive mice and consequently
활성 필터
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.
