콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EMU082841

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Nfe2l2

로그인조직 및 계약 가격 보기

크기 선택

20 μG
₩330,484
50 μG
₩589,817

₩330,484

구입 가능 여부는 고객센터에 문의하십시오.
모든 사진(1)

크기 선택

보기 변경
20 μG
₩330,484
50 μG
₩589,817

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

₩330,484

구입 가능 여부는 고객센터에 문의하십시오.

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

TGGAGAACATTGTCGAGCTGGAGCAAGACTTGGGCCACTTAAAAGACGAGAGAGAAAAACTACTCAGAGAAAAGGGAGAAAACGACAGAAACCTCCATCTACTGAAAAGGCGGCTCAGCACCTTGTATCTTGAAGTCTTCAGCATGTTACGTGATGAGGATGGAAAGCCTTACTCTCCCAGTGAATACTCTCTGCAGCAAACCAGAGATGGCAATGTGTTCCTTGTTCCCAAAAGCAAGAAGCCAGATACAAAGAAAAACTAGGTTCGGGAGGATGGAGCCTTTTCTGAGCTAGTGTTTGTTTTGTACTGCTAAAACTTCCTACTGTGATGTGAAATGCAGAAACACTTTATAAGTAACTATGCAGAATTATAGCCAAAGCTAGTATAGCAATAATATGAAACTTTACAAAGCATTAAAGTCTCAATGTTGAATCAGTTTCATTTTAACTCTCAAGTTAATTTCTTAGGCACCATTTGGGAG

Ensembl | 마우스 수납 번호

ENSMUSG00000015839

NCBI 수납 번호

NM_010902

배송 상태

ambient

저장 온도

−20°C

유전자 정보

mouse ... NFE2L2(18024) , Nfe2l2(18024)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number
HQS
QCS
XWR
AOR

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

COA 검색

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Jie Zhou et al.
PloS one, 9(7), e101668-e101668 (2014-07-06)
Salvianolic acid B (SalB), a bioactive compound isolated from the plant-derived medicinal herb Danshen, has been shown to exert various anti-oxidative and anti-inflammatory activities in several neurological disorders. In this study, we sought to investigate the potential protective effects and
Jian-ping Li et al.
Acta pharmacologica Sinica, 35(8), 1031-1044 (2014-07-01)
To investigate the anti-fibrosis effects of ginsenoside Rg1 on alcohol- and CCl4-induced hepatic fibrosis in rats and to explore the mechanisms of the effects. Rats were given 6% alcohol in water and injected with CCl4 (2 mL/kg, sc) twice a
Amin Haghani et al.
eLife, 9 (2020-06-25)
The neurotoxicity of air pollution is undefined for sex and APOE alleles. These major risk factors of Alzheimer's disease (AD) were examined in mice given chronic exposure to nPM, a nano-sized subfraction of urban air pollution. In the cerebral cortex
Papavee Samatiwat et al.
Naunyn-Schmiedeberg's archives of pharmacology, 388(6), 601-612 (2015-02-25)
Resistance to chemotherapy is the major problem in cancer treatment. Cholangiocarcinoma (CCA) is the tumor arising from the bile duct epithelium. The disease is characterized by very poor prognosis and rarely responds to current radiotherapy or chemotherapy. Transcription factor Nrf2
Baixin Shen et al.
Urology, 84(4), 850-856 (2014-08-12)
To investigate the role and therapeutic potential of Nuclear factor erythroid-related factor 2 (Nrf2) in oxidative stress induced by di-N-butylphthalate (DBP) in testicular Leydig cells. Levels of reactive oxygen species (ROS) and Nrf2 in testicles from offspring of mice fed
모든 관련된 서류 보기

질문

후기

평점 값 없음

활성 필터

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.