콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EMU082041

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Cdh2

로그인조직 및 계약 가격 보기

크기 선택

20 μG
₩330,484
50 μG
₩589,817

₩330,484


예상 입고일2025년 5월 12일세부사항



크기 선택

보기 변경
20 μG
₩330,484
50 μG
₩589,817

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

₩330,484


예상 입고일2025년 5월 12일세부사항


설명

Powered by Eupheria Biotech

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

CATCAATGGCAATCAAGTGGAGAACCCCATTGACATTGTCATCAATGTTATTGACATGAATGATAACAGACCTGAGTTTCTGCACCAGGTTTGGAATGGGTCTGTTCCAGAGGGATCAAAGCCTGGGACGTATGTGATGACGGTCACTGCCATTGATGCGGATGATCCAAATGCCCTGAATGGAATGCTGCGGTACAGGATCCTGTCCCAGGCGCCCAGCACACCTTCACCCAACATGTTTACAATCAACAATGAGACTGGGGACATCATCACTGTGGCAGCTGGTCTGGATCGAGAGAAAGTGCAACAGTATACGTTAATAATTCAAGCCACAGACATGGAAGGCAATCCCACTTATGGCCTTTCAAACACAGCCACAGCCGTCATCACGGTGACAGATGTCAATGACAATCCTCCAGAGTTTACTGCCATGACTTTCTACGGAGAAGTCCCTGAGAACAGGGTGGACGTCAT

Ensembl | 마우스 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

M-R Lee et al.
Cell death & disease, 5, e1113-e1113 (2014-03-15)
Endoplasmic reticulum (ER) stress is considered one of the pathological mechanisms of idiopathic pulmonary fibrosis (IPF). Therefore, we examined whether an ER stress regulator, Bax inhibitor-1 (BI-1), regulates collagen accumulation, which is both a marker of fibrosis and a pathological
Yu-Huan Tsai et al.
PLoS pathogens, 9(5), e1003381-e1003381 (2013-06-06)
Listeria monocytogenes (Lm) is an invasive foodborne pathogen that leads to severe central nervous system and maternal-fetal infections. Lm ability to actively cross the intestinal barrier is one of its key pathogenic properties. Lm crosses the intestinal epithelium upon the
Maorong Jiang et al.
Neurochemical research, 39(11), 2047-2057 (2014-08-15)
Chitosan-based tissue engineered nerve grafts are successfully used for bridging peripheral nerve gaps. The biodegradation products of chitosan are water-dissolvable chitooligosaccharides (COSs), which have been shown to support peripheral nerve regeneration. In this study, we aimed to examine in vitro
Svetlana N Rubtsova et al.
PloS one, 10(7), e0133578-e0133578 (2015-07-25)
Using confocal microscopy, we analyzed the behavior of IAR-6-1, IAR1170, and IAR1162 transformed epithelial cells seeded onto the confluent monolayer of normal IAR-2 epithelial cells. Live-cell imaging of neoplastic cells stably expressing EGFP and of normal epithelial cells stably expressing
Xuebing Yan et al.
Molecular medicine reports, 12(2), 2999-3006 (2015-05-06)
Recent studies have indicated that the epithelial-mesenchymal transition (EMT) is a key molecular mechanism involved in the development of colorectal cancer (CRC). N-cadherin is a mesenchymal marker of the EMT and has been closely linked to several human malignancies. However

질문

후기

평점 값 없음

활성 필터

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.