콘텐츠로 건너뛰기
Merck
모든 사진(1)

문서

EMU075311

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Egfr

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

GCCTGTGGGCCTGACTACTACGAAGTGGAAGAAGATGGCATCCGCAAGTGTAAAAAATGTGATGGGCCCTGTCGCAAAGTTTGTAATGGCATAGGCATTGGTGAATTTAAAGACACACTCTCCATAAATGCTACAAACATCAAACACTTCAAATACTGCACTGCCATCAGCGGGGACCTTCACATCCTGCCAGTGGCCTTTAAGGGGGATTCTTTCACGCGCACTCCTCCTCTAGACCCACGAGAACTAGAAATTCTAAAAACCGTAAAGGAAATAACAGGCTTTTTGCTGATTCAGGCTTGGCCTGATAACTGGACTGACCTCCATGCTTTCGAGAACCTAGAAATAATACGTGGCAGAACAAAGCAACATGGTCAGTTTTCTTTGGCGGTCGTTGGCCTGAACATCACATCACTGGGGCTGCGTTCCCTCAAGGAGATCAG

Ensembl | 마우스 수납 번호

ENSMUSG00000020122

NCBI 수납 번호

NM_007912

배송 상태

ambient

저장 온도

−20°C

유전자 정보

mouse ... EGFR(13649) , Egfr(13649)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Began Gopalan et al.
Biomaterials, 35(26), 7479-7487 (2014-06-11)
Hepatocellular carcinoma (HCC) is one of the most commonly diagnosed lethal cancers in the world. We previously showed two imidazolium salts (IBN-1 and IBN-9) with a moderate efficacy for HCC. Here we report a more potent imidazolium compound IBN-65 (1-benzyl-2-phenyl-3-(4-isopropyl)-benzyl-imidazolium
Ijeoma Adaku Umelo et al.
Lung cancer (Amsterdam, Netherlands), 90(2), 167-174 (2015-09-08)
Lung cancer remains the leading cause of cancer-related mortality worldwide, with metastatic disease frequently a prominent feature at the time of diagnosis. The role of NSCLC-derived EGFR mutations in cancer cell proliferation and survival has been widely reported, but little
Chuen-Mao Yang et al.
Journal of cellular physiology, 230(10), 2351-2361 (2015-04-30)
Carbon monoxide (CO), a reaction product of the cytoprotective heme oxygenase (HO)-1, displays an anti-inflammatory effect in various cellular injuries, but the precise mechanisms of HO-1 expression remain unknown. We used the transition metal carbonyl compound carbon monoxide-releasing molecule-2 (CORM-2)
Philippe Dje N'Guessan et al.
Biochemical and biophysical research communications, 450(2), 1038-1044 (2014-07-01)
Chronic lower airway inflammation is considered to be a major cause of pathogenesis and disease progression in chronic obstructive pulmonary disease (COPD). Moraxella catarrhalis is a COPD-associated pathogen causing exacerbations and bacterial colonization in the lower airways of patients, which
Xingchen Zhou et al.
PloS one, 9(5), e96718-e96718 (2014-05-13)
Epidermal growth factor receptor (EGFR) overexpression and activation result in increased proliferation and migration of solid tumors including ovarian cancer. In recent years, mounting evidence indicates that EGFR is a direct and functional target of miR-7. In this study, we
모든 관련된 서류 보기

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.