콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EMU075181

Sigma-Aldrich

MISSION® esiRNA

targeting mouse E2f1

로그인조직 및 계약 가격 보기

크기 선택

20 μG
₩330,484
50 μG
₩589,817

₩330,484


예상 입고일2025년 4월 04일세부사항



크기 선택

보기 변경
20 μG
₩330,484
50 μG
₩589,817

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

₩330,484


예상 입고일2025년 4월 04일세부사항


설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

GCTGGATCTGGAGACTGACCATCAGTACCTCGCTGGTAGCAGTGGGCCATTCCGGGGCAGAGGCCGCCACCCAGGGAAAGGTGTGAAATCTCCGGGGGAGAAGTCACGCTATGAAACCTCACTAAATCTGACCACCAAACGCTTCTTGGAGCTGCTGAGCCGCTCAGCTGACGGTGTCGTTGACCTGAACTGGGCAGCTGAGGTGCTGAAGGTGCAGAAACGGCGCATCTATGACATCACCAATGTCCTGGAGGGCATCCAGCTCATTGCCAAGAAGTCCAAGAATCATATCCAGTGGCTAGGCAGCCACACCATGGTGGGGATTGGTAAGCGGCTTGAAGGCCTGACCCAGGACCTGCAGCAACTGCAGGAGAGTGAGCAGCAGCTGGATCACCTGATGCACATCTGTACCACACAGCTGCAACTGCTTTCGGAGGACTC

Ensembl | 마우스 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Wanghao Chen et al.
Journal of neuro-oncology, 120(1), 43-53 (2014-08-21)
MicroRNAs (miRNAs) have gained much attention due to their critical roles in diverse biological events, including tumorigenesis. In this study, we demonstrate that miR-136 is down-regulated in two cohorts of patients with glioma. Furthermore, the low-level expression of miR-136 is
Xiaolei Jiang et al.
PloS one, 10(6), e0127951-e0127951 (2015-06-04)
The E2F1 transcription factor regulates cell proliferation and apoptosis through the control of a considerable variety of target genes. Previous work has detailed the role of other transcription factors in mediating the specificity of E2F function. Here we identify the
T J Kaitu'u-Lino et al.
Placenta, 36(8), 932-937 (2015-07-07)
Preeclampsia is a serious complication of pregnancy for which there are no efficacious medical treatments. Soluble endoglin is as an anti-angiogenic factor that contributes to the pathogenesis of the disease, however little is known about its molecular regulation in placenta.
Ning-Ai Liu et al.
The Journal of clinical endocrinology and metabolism, 100(7), 2557-2564 (2015-05-06)
Cushing disease, due to pituitary corticotroph tumor ACTH hypersecretion, drives excess adrenal cortisol production with adverse morbidity and mortality. Loss of glucocorticoid negative feedback on the hypothalamic-pituitary-adrenal axis leads to autonomous transcription of the corticotroph precursor hormone proopiomelanocortin (POMC), consequent

질문

후기

평점 값 없음

활성 필터

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.