추천 제품
설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
AGGACCTCGAGGCTCTTCTCAACTCCAAGGAAGCTGCCCTGAGCACTGCTCTCAGTGAGAAGCGCACATTGGAGGGCGAGCTCCATGACCTGCGGGGGCAGGTAGCCAAGCTTGAGGCGGCCCTGGGAGAGGCTAAGAAGCAGCTTCAGGATGAGATGCTGAGGCGAGTGGATGCTGAGAACAGGCTACAGACGCTGAAGGAGGAGCTTGACTTCCAGAAGAACATTTACAGCGAGGAACTGCGTGAGACCAAGCGCCGGCATGAGACGCGGCTTGTGGAGATCGATAACGGGAAGCAGCGAGAGTTTGAGAGCCGGCTGGCAGATGCCCTGCAGGAGCTGCGGGCTCAGCATGAGGACCAGGTGGAACAGTATAAGAAGGAGCTAGAAAAGACATACTCCGCCAAGCTGGATAATGCCAGGCAGTCTGCTGAGAGGAACAGCAACCTCGTGGGGGCTGCCCATGAGGAACTGCAGCAGTCTCGAATCCGCATTGAC
Ensembl | 마우스 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
mouse ... LMNA(16905) , Lmna(16905)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Jung-Sun Lee et al.
Oncotarget, 6(6), 4051-4065 (2015-03-03)
c-Met, a cognate receptor tyrosine kinase of hepatocyte growth factor, is overexpressed and/or mutated in number of tumors. Therefore, abrogation of c-Met signaling may serve as potential therapeutic targets. In this study, we generated Ads expressing single shRNA specific to
Tom Sieprath et al.
Nucleus (Austin, Tex.), 6(3), 236-246 (2015-05-23)
The cell nucleus is structurally and functionally organized by lamins, intermediate filament proteins that form the nuclear lamina. Point mutations in genes that encode a specific subset of lamins, the A-type lamins, cause a spectrum of diseases termed laminopathies. Recent
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.