콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EMU053261

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Rapgef3

로그인조직 및 계약 가격 보기

크기 선택

20 μG
₩330,484
50 μG
₩589,817

₩330,484


예상 입고일2025년 5월 19일세부사항



크기 선택

보기 변경
20 μG
₩330,484
50 μG
₩589,817

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

₩330,484


예상 입고일2025년 5월 19일세부사항


설명

Powered by Eupheria Biotech

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

GCTCTTTGAACCACACAGCAAGGCAGGAACTGTGTTGTTCAGCCAGGGGGACAAGGGTACCTCGTGGTACATTATCTGGAAGGGATCTGTCAATGTGGTGACCCATGGCAAGGGGCTGGTGACCACGTTGCACGAGGGAGATGACTTTGGACAGCTGGCTCTGGTGAACGACGCACCTCGGGCAGCCACCATCATCCTTCGAGAAAATAACTGTCACTTTCTGCGTGTGGACAAGCAGGACTTCAACCGCATCATCAAGGATGTGGAAGCAAAAACCATGAGACTGGAAGAACACGGCAAAGTGGTCTTAGTTCTGGAGAGAACCTCTCAGGGTGCTGGCCCTTCCCGTCCCCCGACCCCAGGCAGGAACCGGTATACGGTCATGTCTGGCACCCCAGAGAAAATCCTAGAACTGCTGTTGGAGGCTATGAGACCGGATTCCAGTGCTCATGACCCAACAG

Ensembl | 마우스 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Andrea Heldsinger et al.
Endocrinology, 155(10), 3956-3969 (2014-07-26)
The anorexigenic adipocyte-derived hormone leptin and the orexigenic hormone ghrelin act in opposition to regulate feeding behavior via the vagal afferent pathways. The mechanisms by which ghrelin exerts its inhibitory effects on leptin are unknown. We hypothesized that ghrelin activates
Kazuya Kusama et al.
Reproduction (Cambridge, England), 147(6), 897-906 (2014-03-04)
The optimal decidualization of endometrial stromal cells (ESCs) following embryo implantation is one of the critical steps to establish pregnancy in rodents and humans. This step is intricately regulated by ovarian hormones. Using in vitro human ESCs model, we previously
Ke Ke et al.
PloS one, 10(5), e0124869-e0124869 (2015-05-21)
Cilostazol has been reported to alleviate the metabolic syndrome induced by increased intracellular adenosine 3',5'-cyclic monophosphate (cAMP) levels, which is also associated with osteoclast (OC) differentiation. We hypothesized that bone loss might be attenuated via an action on OC by
Pablo Muñoz-Llancao et al.
The Journal of neuroscience : the official journal of the Society for Neuroscience, 35(32), 11315-11329 (2015-08-14)
Acquisition of neuronal polarity is a complex process involving cellular and molecular events. The second messenger cAMP is involved in axonal specification through activation of protein kinase A. However, an alternative cAMP-dependent mechanism involves the exchange protein directly activated by
Supachoke Mangmool et al.
Molecular endocrinology (Baltimore, Md.), 29(4), 583-596 (2015-02-27)
Although the cardioprotective effects of glucagon-like peptide-1 and its analogs have been reported, the exact mechanisms of the glucagon-like peptide-1 receptor (GLP-1R) signaling pathway in the heart are still unclear. Activation of the GLP-1R has been shown to increase cAMP

질문

후기

평점 값 없음

활성 필터

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.