설명
Powered by Eupheria Biotech
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
CTTGAAGGAGCTTGGGACTGGACAATTCGGTGTCGTGAAATATGGGAAGTGGAGGGGCCAATATGATGTGGCCATCAAGATGATCAGAGAAGGTTCCATGTCGGAGGATGAATTCATTGAAGAAGCCAAAGTCATGATGAATCTTTCCCATGAGAAGCTGGTGCAGTTGTATGGCGTCTGCACCAAACAACGCCCCATCTTCATCATCACCGAGTACATGGCTAATGGCTGCCTCTTGAACTACCTGAGGGAGATGCGGCACCGCTTCCAGACACAGCAGCTGCTTGAGATGTGCAAAGATGTCTGTGAAGCAATGGAATACTTGGAGTCGAAGCAGTTCCTTCACAGAGACCTGGCAGCTCGAAACTGTTTGGTAAACGATCAAGGAGTTGTGAAAGTATCTGACTTTGGCCTGTCTAGGTATGTCCTTGATGATGAGTACACCAGCTCTGTAGGCTCCAAGTTTCCAGTTCGGTGGT
Ensembl | 마우스 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
mouse ... BTK(12229) , Btk(12229)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Agnieszka Krupa et al.
American journal of physiology. Lung cellular and molecular physiology, 307(6), L435-L448 (2014-08-03)
Previous observations made by our laboratory indicate that Bruton's tyrosine kinase (Btk) may play an important role in the pathophysiology of local inflammation in acute lung injury (ALI)/acute respiratory distress syndrome (ARDS). We have shown that there is cross talk
Genevra Pillinger et al.
Scientific reports, 5, 12949-12949 (2015-08-22)
Approximately 20% of patients with acute myeloid leukaemia (AML) have a mutation in FMS-like-tyrosine-kinase-3 (FLT3). FLT3 is a trans-membrane receptor with a tyrosine kinase domain which, when activated, initiates a cascade of phosphorylated proteins including the SRC family of kinases.
Angela Marina Montalbano et al.
European journal of pharmacology, 736, 35-43 (2014-05-07)
Cigarette smoke extract (CSE) affects the expression of Choline Acetyl-Transferase (ChAT), muscarinic acetylcholine receptors, and mucin production in bronchial epithelial cells. Mucin 5AC (MUC5AC), muscarinic acetylcholine receptor M3, ChAT expression, acetylcholine levels and acetylcholine binding were measured in a human
Neeraj Maurya et al.
Journal of immunology (Baltimore, Md. : 1950), 193(7), 3417-3425 (2014-08-31)
The receptor T cell Ig and mucin protein-3 (TIM-3) has emerged as an important regulator of innate immune responses. However, whether TIM-3-induced signaling promotes or inhibits the activation and maturation of dendritic cells (DCs) still remains uncertain. In addition, the
Panyu Zhou et al.
Cell biochemistry and biophysics, 70(2), 1265-1275 (2014-06-08)
Sepsis is a common and critical complication in surgical patients that often leads to multiple organ failure syndrome (MOFS), including acute lung injury (ALI) and acute respiratory distress syndrome (ARDS). Despite intensive supportive care and treatment modalities, the mortality of
활성 필터
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.
