설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
TGCTCGAATGAACACTCTGGAGATGACACCTGAGGTCAAGCACAGGGTGACAGAAGAGGCTAAGACCGCCTTCCTGCTCAACATTGAGCTGTTTGAGGAGCTGCAGGTGATGCTGACAGAGGAACACAAAGACCAGAGTCCCTCACAGATGGCGTCACTTCGTCAGAGGCCTGCTAGCCTGGTGCAAGATACTGCCCCTGCAGAGACACCCCGAGGGAAACCCCAGATCAGCACTAGCTCATCCCAGACACCGCTCCTCCAGTGGGTCCTCACTCTCAGCTTCCTGTTGGCAACAGTGGCAGTGGGAATTTATGCCATGTAAATGCAATACTGGCCCCCAGGGGCTGTGAACTCTGTCCAATGTGGCCTTCTCTCTGTAAGGGAGAATCTTGCCTGGCTCTCTTCTCTTGGGCCTCTAAGAAAGCTTTTGGGGTCCCTAGCCCACTCCCTGTGTTTC
Ensembl | 마우스 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
mouse ... HMOX1(15368) , Hmox1(15368)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Gi Soo Youn et al.
Toxicology and applied pharmacology, 280(1), 42-52 (2014-07-30)
HIV-1 Tat causes extensive neuroinflammation that may progress to AIDS-related encephalitis and dementia. Celastrol possesses various biological activities such as anti-oxidant, anti-tumor, and anti-inflammatory activities. In this study, we investigated the modulatory effects of celastrol on HIV-1 Tat-induced inflammatory responses
So Ra Kim et al.
Biochemical pharmacology, 95(4), 279-289 (2015-04-22)
High mobility group box 1 (HMGB1) is now recognized as a late mediator of sepsis. We tested hypothesis that ascorbic acid (AscA) induces heme oxygenase (HO)-1 which inhibits HMGB1 release in lipopolysaccharide (LPS)-stimulated cells and increases survival of septic mice.
Yun-Jeong Choe et al.
International journal of oncology, 44(3), 761-768 (2013-12-25)
A recent study reported that p53 can induce HO-1 by directly binding to the putative p53 responsive element in the HO-1 promoter. In this study, we report that nutlin-3, a small molecule antagonist of HDM2, induces the transcription of HO-1
Li-Chin Sung et al.
Clinical and experimental pharmacology & physiology, 42(6), 632-639 (2015-05-02)
Lycopene is the most potent active antioxidant among the major carotenoids, and its use has been associated with a reduced risk for cardiovascular disease (CVD). Endothelin-1 (ET-1) is a powerful vasopressor synthesized by endothelial cells and plays a crucial role
Xiao Qiao Wang et al.
Biomedical and environmental sciences : BES, 27(10), 786-793 (2014-10-25)
To assess the effect of atorvastatin on lipopolysaccharide (LPS)-induced TNF-α production in RAW264.7 macrophages. RAW264.7 macrophages were treated in different LPS concentrations or at different time points with or without atorvastatin. TNF-α level in supernatant was measured. Expressions of TNF-α
활성 필터
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.
