콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EMU012771

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Serpine2

로그인조직 및 계약 가격 보기

크기 선택

20 μG
₩330,484
50 μG
₩589,817

₩330,484


예상 입고일2025년 5월 07일세부사항



크기 선택

보기 변경
20 μG
₩330,484
50 μG
₩589,817

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

₩330,484


예상 입고일2025년 5월 07일세부사항


설명

Powered by Eupheria Biotech

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

TGGTCCTCGTTAATGCAGTGTATTTCAAGGGTTTGTGGAAGTCTCGGTTTCAACCAGAGAGCACAAAGAAACGGACATTCGTGGCAGGTGATGGGAAATCCTACCAAGTACCCATGTTGGCTCAGCTCTCTGTGTTCCGCTCAGGGTCTACCAGGACCCCGAATGGCTTATGGTACAACTTCATTGAGCTGCCCTACCATGGTGAGAGCATCAGCATGCTGATCGCCCTGCCAACAGAGAGCTCCACCCCACTGTCTGCCATCATCCCTCACATCACTACCAAGACCATTGATAGCTGGATGAACACCATGGTACCCAAGAGGATGCAGCTGGTCCTACCCAAGTTCACAGCTGTGGCACAAACAGATCTGAAGGAGCCACTGAAAGCCCTTGGCATTACTGAGATGTTTGAGCCATCAAAGGC

Ensembl | 마우스 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

En-Dong Zhu et al.
PloS one, 9(8), e106049-e106049 (2014-08-30)
Gastric cancer is one of the most common malignant diseases worldwide. Emerging evidence has shown that microRNAs (miRNAs) are associated with tumor development and progression. Our previous studies have revealed that H. pylori infection was able to induce the altered
Kun Wang et al.
Journal of cancer research and clinical oncology, 141(5), 805-812 (2014-11-02)
Altered expression of serine protease inhibitor peptidase inhibitor clade E member 2 (SERPINE2) associates with human cancer development and progression; thus, this study investigated SERPINE2 expression in gastric cancer tissues for association with clinicopathological and survival data from the patients
Ruozhi Zhao et al.
Journal of leukocyte biology, 95(6), 941-949 (2014-02-06)
Diabetes mellitus accelerates the development of atherosclerotic cardiovascular diseases. Monocyte adhesion is an early cellular event of atherogenesis. Elevated levels of glyLDL were common in diabetic patients. Our previous studies indicated that HSF1 and p22-phox (a subunit of the NOX

질문

후기

평점 값 없음

활성 필터

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.