콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU225481

Sigma-Aldrich

MISSION® esiRNA

targeting human IGHM

로그인조직 및 계약 가격 보기

크기 선택

20 μG
₩330,484
50 μG
₩570,633

₩330,484

예상 입고일2025년 5월 07일세부사항

모든 사진(1)

크기 선택

보기 변경
20 μG
₩330,484
50 μG
₩570,633

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

₩330,484

예상 입고일2025년 5월 07일세부사항

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

CTGCCTCGCACAGGACTTCCTTCCCGACTCCATCACTTTCTCCTGGAAATACAAGAACAACTCTGACATCAGCAGCACCCGGGGCTTCCCATCAGTCCTGAGAGGGGGCAAGTACGCAGCCACCTCACAGGTGCTGCTGCCTTCCAAGGACGTCATGCAGGGCACAGACGAACACGTGGTGTGCAAAGTCCAGCACCCCAACGGCAACAAAGAAAAGAACGTGCCTCTTCCAGTGATTGCCGAGCTGCCTCCCAAAGTGAGCGTCTTCGTCCCACCCCGCGACGGCTTCTTCGGCAACCCCCGCAAGTCCAAGCTCATCTGCCAGGCCACGGGTTTCAGTCCCCGGCAGATTCAGGTGTCCTGGCTGCGCGAGGGGAAGCAGGTGGGGTCTGGCGTCACCACGGACCAGGTGCAGGCTGAGGCCAAAGAGTCTGGGCCCACGACCTACAAGGTGACCAGCACACTGACCATCAAAGAGAGCGACTGGCTCAGCCAGAGCATGTTCACCTGC

Ensembl | 인체 수납 번호

ENSG00000211899

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... IGHM(3507)

관련 카테고리

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our 문서 section.

도움이 필요하시면 연락하세요. 고객 지원 부서

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Ai Kawamoto-Hirano et al.
The Annals of otology, rhinology, and laryngology, 125(3), 219-227 (2015-09-24)
To clarify composite fibers and cells in the synovial tissues of the cricoarytenoid joint (CA joint). Routine histology and immunohistrochemistry using sagittal or nearly sagittal sections obtained from 18 elderly cadaveric specimens. The CA joint capsule was thin and contained
J Westra et al.
Clinical and experimental immunology, 178(1), 40-47 (2014-06-04)
Rituximab (RTX) treatment in rheumatoid arthritis (RA) patients severely hampers humoral response after influenza vaccination as determined by haemagglutination inhibition assay (HI). It is not known whether HI reflects both immunoglobulin (Ig)M and IgG (subclass) influenza response, and whether IgM
Elvira Bailón et al.
Journal of leukocyte biology, 96(2), 185-199 (2014-08-01)
This study addresses the role of (pro)MMP-9 overexpression in CLL cell migration. We have used primary CLL cells and CLL-derived MEC-1 cells transfected with empty (mock cells) or proMMP-9-encoding (MMP-9 cells) lentiviral vectors. The constitutive (pro)MMP-9 expression in mock cells
Willem J J Falkenburg et al.
Arthritis & rheumatology (Hoboken, N.J.), 67(12), 3124-3134 (2015-08-08)
To investigate the presence and patterns of specific IgG subclass recognition by IgM rheumatoid factor (IgM-RF) and IgA-RF with a newly developed enzyme-linked immunosorbent assay (ELISA), which can discriminate between polyspecific and restricted RF responses. Polyspecific and restricted RF responses
Elisabeth M Meulenbroek et al.
Haematologica, 100(11), 1407-1414 (2015-09-12)
In autoimmune hemolytic anemia autoantibodies against erythrocytes lead to increased clearance of the erythrocytes, which in turn results in a potentially fatal hemolytic anemia. Depending on whether IgG or IgM antibodies are involved, response to therapy is different. Proper identification

질문

후기

평점 값 없음

활성 필터

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.