설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
CACCACCACCAGCTATGAGAAGATAGTGGGCAACACCAAAGTCCTGGAGATACCCTTGGAGCCCAAAAACAACATGAGGGCAACCATCGACTGTGCGGGGATCTTGAAGCTTAGAAACGCCGACATTGAGCTGCGGAAAGGCGAGACGGACATTGGAAGAAAGAACACGCGGGTGAGACTGGTTTTCCGAGTTCACATCCCAGAGTCCAGTGGCAGAATCGTCTCTTTACAGACTGCATCTAACCCCATCGAGTGCTCCCAGCGATCTGCTCACGAGCTGCCCATGGTTGAAAGACAAGACACAGACAGCTGCCTGGTCTATGGCGGCCAGCAAATGATCCTCACGGGGCAGAACTTTACATCCGAGTCCAAAGTTGTGTTTACTGAGAAGACCACAGATGGACAGCAAATTTGGG
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... NFATC2(4773) , NFATC2(4773)
일반 설명
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Joyce V Lee et al.
Genes & development, 32(7-8), 497-511 (2018-04-21)
The metabolite acetyl-coenzyme A (acetyl-CoA) is the required acetyl donor for lysine acetylation and thereby links metabolism, signaling, and epigenetics. Nutrient availability alters acetyl-CoA levels in cancer cells, correlating with changes in global histone acetylation and gene expression. However, the
Yanjiao Huang et al.
Experimental and therapeutic medicine, 20(2), 736-747 (2020-08-04)
Store-operated Ca2+ entry (SOCE) is the stable calcium channel influx in most cells. It consists of the cytoplasmic ion channel ORAI and endoplasmic reticulum receptor stromal interaction molecule 1 (STIM1). Abolition of SOCE function due to ORAI1 and STIM1 gene
Jasper Wouters et al.
Nature cell biology, 22(8), 986-998 (2020-08-06)
Melanoma cells can switch between a melanocytic and a mesenchymal-like state. Scattered evidence indicates that additional intermediate state(s) may exist. Here, to search for such states and decipher their underlying gene regulatory network (GRN), we studied 10 melanoma cultures using
Christina Springstead Scanlon et al.
Nature communications, 6, 6885-6885 (2015-04-29)
Perineural invasion (PNI) is an indicator of poor survival in multiple cancers. Unfortunately, there is no targeted treatment for PNI since the molecular mechanisms are largely unknown. PNI is an active process, suggesting that cancer cells communicate with nerves. However
활성 필터
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.
