설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
GGGGAGCAGATGAAGGTGTACAAGTGCGAACACTGCCGGGTGCTCTTCCTGGATCACGTCATGTACACCATCCACATGGGCTGCCACGGCTTCCGTGATCCTTTTGAGTGCAACATGTGCGGCTACCACAGCCAGGACCGGTACGAGTTCTCGTCGCACATAACGCGAGGGGAGCACCGCTTCCACATGAGCTAAAGCCCTCCCGCGCCCCCACCCCAGACCCCGAGCCACCCCAGGAAAAGCACAAGGACTGCCGCCTTCTCGCTCCCGCCAGCAGCATAGACTGGACTGGACCAGACAATGTTGTGTTTGGATTTGTAACTGTTTTTTGTTTTTTGTTTGAGTTGGTTGATTGGGGTTTGATTTGCTTTTGAAAAGATTTTTATTTTTAGAGGCAGGGCTGCATTGGGAGCATCCAGAACTGCTACCTTCCTAGATGTTTCCCCAGACCGCTGGCTGAGATTCCCTCACCTGTCGCTTCCTAG
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... IKZF1(10320) , IKZF1(10320)
일반 설명
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Ipsita Guha et al.
Frontiers in immunology, 11, 898-898 (2020-06-26)
Tumor progression in the host leads to severe impairment of intrathymic T-cell differentiation/maturation, leading to the paralysis of cellular anti-tumor immunity. Such suppression manifests the erosion of CD4+CD8+ double-positive (DP) immature thymocytes and a gradual increase in CD4-CD8- double negative
Maud Lemarié et al.
PLoS genetics, 17(3), e1009478-e1009478 (2021-03-27)
The tumor suppressor IKAROS binds and represses multiple NOTCH target genes. For their induction upon NOTCH signaling, IKAROS is removed and replaced by NOTCH Intracellular Domain (NICD)-associated proteins. However, IKAROS remains associated to other NOTCH activated genes upon signaling and
Nicholas A Vitanza et al.
Pediatric blood & cancer, 61(10), 1779-1785 (2014-07-01)
Ikaros, the product of IKZF1, is a regulator of lymphoid development and polymorphisms in the gene have been associated with the acute lymphoblastic leukemia (ALL). Additionally, IKZF1 deletions and mutations identify high-risk biological subsets of childhood ALL [Georgopoulos et al.
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.