설명
Powered by Eupheria Biotech
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
GGGAGGCAAGGTTATATGCACTTTCTCATGATTTACAGAGAAGTGAATAACTGCAAAGTGAAGTTGCTTCTTCTACTTCAGTCTTCTCTCACTTTGATTTGCTAGTTGTTATCAATTAATGACAATTACAAACCTACTGTATCTCTAATACAGTGTGACTGGTCAGGTATTTCAGTTCTTAGGAAGGAAGTGCCAAGTTTGTTTTTGGGTTCCTGGAACAGCGCTCACCTTTGTTTAGAACACTGGTTTAAAGGGATAATCATCTCTGTCACATTAGACTATCCATCATGACCAGCAAATACTCATTTTAGGAAAAAAAAAAGCATGATCTGAAAAATACTTTTGGTGGTATGTTGGTTACCCTCCTAGCTTTCCATTTGGTTTAGAACATAAAGCAAATAGACACAGTCATACTGTCACTGCTCTGGACTGTGTGGAGCTCGCTAAAGTCA
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... PIK3R1(5295) , PIK3R1(5295)
일반 설명
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Xinran Li et al.
Nature communications, 10(1), 716-716 (2019-02-14)
Copy number loss of PIK3R1 (p85α) most commonly occurs in ovarian cancer among all cancer types. Here we report that ovarian cancer cells manifest a spectrum of tumorigenic phenotypes upon knockdown of PIK3R1. PIK3R1 loss activates AKT and p110-independent JAK2/STAT3
Reem Ali et al.
Cells, 8(10) (2019-10-23)
Ataxia-telegiectasia mutated (ATM), phosphatase and tensin homolog (PTEN), and p85α are key tumour suppressors. Whether ATM regulates PTEN expression and influence platinum sensitivity is unknown. We generated ATM knockdowns (KD) and CRISPR knock outs (KO) in glioblastoma (LN18, LN229) and
Jun Xu et al.
Molecular medicine reports, 12(3), 4708-4712 (2015-06-24)
The expression of osteopontin (OPN) and vascular endothelial growth factor (VEGF) are associated with the severity of cartilage destruction in osteoarthritis. However, the biological connection between OPN and VEGF in osteoarthritis remains to be elucidated. The present study was performed
Xue Bai et al.
Oncology reports, 33(6), 3085-3092 (2015-05-13)
Cervical cancer is the second most common women carcinoma worldwide and the fourth leading cause of cancer-associated mortality in women. Butein, a bioactive flavonoid isolated from numerous native plants, has been shown to induce apoptosis and inhibits migration and invasion
Zhenyou Zou et al.
Journal of drug targeting, 22(9), 839-848 (2014-07-16)
Multi-drug resistance (MDR) cancer is an intractable problem. Over-expression of drug efflux transporters such as ABCB1, ABCC1 and ABCG2 contributes to it, by which they pump drugs out of cells, and result in the decrease in the efficacy of chemotherapy.
활성 필터
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.
