설명
Powered by Eupheria Biotech
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
CCATGGTCCTTGAGGTGAGTGACCACCAAGTGCTAAATGACGCCGAGGTTGCCGCCCTCCTGGAGAACTTCAGCTCTTCCTATGACTATGGAGAAAACGAGAGTGACTCGTGCTGTACCTCCCCGCCCTGCCCACAGGACTTCAGCCTGAACTTCGACCGGGCCTTCCTGCCAGCCCTCTACAGCCTCCTCTTTCTGCTGGGGCTGCTGGGCAACGGCGCGGTGGCAGCCGTGCTGCTGAGCCGGCGGACAGCCCTGAGCAGCACCGACACCTTCCTGCTCCACCTAGCTGTAGCAGACACGCTGCTGGTGCTGACACTGCCGCTCTGGGCAGTGGACGCTGCCGTCCAGTGGGTCTTTGGCTCTGGCCTCTGCAAAGTGGCAGGTGCCCTCTTCAACATCAACTTCTACGCAGGAGCCCTCCTGCTGGCCTGCATCAGCTTTGACCGCTACCTGAAC
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... CXCR3(2833) , CXCR3(2833)
일반 설명
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Cecelia C Yates-Binder et al.
PloS one, 7(7), e40812-e40812 (2012-07-21)
Angiogenesis plays a critical role in processes such as organ development, wound healing, and tumor growth. It requires well-orchestrated integration of soluble and matrix factors and timely recognition of such signals to regulate this process. Previous work has shown that
Pro-Inflammatory CXCR3 Impairs Mitochondrial Function in Experimental Non-Alcoholic Steatohepatitis.
Jinghua Du et al.
Theranostics, 7(17), 4192-4203 (2017-11-22)
Mitochondrial dysfunction plays a crucial role in the development of non-alcoholic steatohepatitis (NASH). However, the regulator of mitochondrial dysfunction in the pathogenesis of NASH is still largely unclear. CXCR3 is an essential pro-inflammatory factor in chronic liver diseases. We explored
Oisun Jung et al.
Journal of cell science, 132(20) (2019-09-29)
When targeted by the tumor-promoting enzyme heparanase, cleaved and shed syndecan-1 (Sdc1) then couples VEGFR2 (also known as KDR) to VLA-4, activating VEGFR2 and the directed migration of myeloma cells. But how VEGFR2 activates VLA-4-mediated motility has remained unknown. We now
활성 필터
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.
