콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU145981

Sigma-Aldrich

MISSION® esiRNA

targeting human BCL11A

로그인조직 및 계약 가격 보기

크기 선택

20 μG
₩330,484
50 μG
₩589,817

₩330,484


예상 입고일2025년 4월 14일세부사항



크기 선택

보기 변경
20 μG
₩330,484
50 μG
₩589,817

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

₩330,484


예상 입고일2025년 4월 14일세부사항


설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

CCCTTCAGGACTAGGTGCAGAATGTCCTTCCCAGCCACCTCTCCATGGGATTCATATTGCAGACAATAACCCCTTTAACCTGCTAAGAATACCAGGATCAGTATCGAGAGAGGCTTCCGGCCTGGCAGAAGGGCGCTTTCCACCCACTCCCCCCCTGTTTAGTCCACCACCGAGACATCACTTGGACCCCCACCGCATAGAGCGCCTGGGGGCGGAAGAGATGGCCCTGGCCACCCATCACCCGAGTGCCTTTGACAGGGTGCTGCGGTTGAATCCAATGGCTATGGAGCCTCCCGCCATGGATTTCTCTAGGAGACTTAGAGAGCTGGCAGGGAACACGTCTAGCCCACCGCTGTCCCCAGGCCGGCCCAGCCCTATGCAAAGGTTACTGCAACCATTCCAGCCAGGTAGCAAGCCGCCCTTCCTGGCGACGCCCCCCCTCCCTCCTCTGCAATCCGCCCCTCCTCCCTCCCAGCCCCCGGTCAAGTCCAAGTCATGCGAGTTCTG

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Chen-Han Zhang et al.
Oncotarget, 8(51), 88658-88669 (2017-11-29)
Tamoxifen resistance is a serious problem in the endocrine therapy of breast cancer. Long non-coding RNAs play important roles in tumor development. In this study, we revealed the involvement of lncRNA uc.57 and its downstream gene BCL11A in TAM resistance.
Samarwadee Plianwong et al.
Pharmaceutical research, 37(3), 46-46 (2020-02-06)
Short interfering RNA (siRNA) therapy promises a new era in treatment of breast cancers but effective delivery systems are needed for clinical use. Since silencing complementary targets may offer improved efficacy, this study was undertaken to identify non-viral carriers for
Alberto Daniel-Moreno et al.
Blood cells, molecules & diseases, 84, 102456-102456 (2020-06-05)
β-Hemoglobinopathies are among the most common single-gene disorders and are caused by different mutations in the β-globin gene. Recent curative therapeutic approaches for these disorders utilize lentiviral vectors (LVs) to introduce a functional copy of the β-globin gene into the
Petros Papadopoulos et al.
Human genomics, 14(1), 39-39 (2020-10-18)
The expression of the human β-like globin genes follows a well-orchestrated developmental pattern, undergoing two essential switches, the first one during the first weeks of gestation (ε to γ), and the second one during the perinatal period (γ to β).

질문

후기

평점 값 없음

활성 필터

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.