콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU145491

Sigma-Aldrich

MISSION® esiRNA

targeting human MEF2D

로그인조직 및 계약 가격 보기

크기 선택

20 μG
₩330,484
50 μG
₩589,817

₩330,484

예상 입고일2025년 5월 07일세부사항

모든 사진(1)

크기 선택

보기 변경
20 μG
₩330,484
50 μG
₩589,817

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

₩330,484

예상 입고일2025년 5월 07일세부사항

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

CCCACTGCCTACAACACAGATTACCAGTTGACCAGTGCAGAGCTCTCCTCCTTACCAGCCTTTAGTTCACCTGGGGGGCTGTCGCTAGGCAATGTCACTGCCTGGCAACAGCCACAGCAGCCCCAGCAGCCGCAGCAGCCACAGCCTCCACAGCAGCAGCCACCGCAGCCACAGCAGCCACAGCCACAGCAGCCTCAGCAGCCGCAACAGCCACCTCAGCAACAGTCCCACCTGGTCCCTGTATCTCTCAGCAACCTCATCCCGGGCAGCCCCCTGCCCCACGTGGGTGCTGCCCTCACAGTCACCACCCACCCCCACATCAGCATCAAGTCAGAACCGGTGTCCCCAAGCCGTGAGCGCAGCCCTGCGCCTCCCCCTCCAGCTGTGTTCCCAGCTGCCCGCCCTGAGCCTGGCGATGGTCTCAGCAGCCCAGCCGGGGGATCCTATGAGACGGGAGACCGGGATGACGGACGGGGGGACTTCGGGCCCACACTGGGCCTGCTGCGCCCAGCCCCAGAGCCTGAGGCTGAGGGCTCAGCTGTGAAGAGGATGCGGCTTGATA

Ensembl | 인체 수납 번호

ENSG00000116604

NCBI 수납 번호

NM_005920

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... MEF2D(4209) , MEF2D(4209)

관련 카테고리

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number
JRR

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

COA 검색

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Shuna Li et al.
Aging, 12(7), 6456-6466 (2020-04-10)
Cochlear ribbon synapses play a pivotal role in the prompt and precise acoustic signal transmission from inner hair cells (IHCs) to the spiral ganglion neurons, while noise and aging can damage ribbon synapses, resulting in sensorineural hearing loss. Recently, we
Yaru Dong et al.
Neurochemical research, 46(2), 299-308 (2020-11-13)
Parkinson's disease (PD) is a severe neurodegenerative disease characterized by selective loss of dopaminergic neurons, which reduces quality of life of patients and poses a heavy burden to the society. The pathological mechanism of PD remains unclear, and increasing efforts
Haiyun Chen et al.
Aging, 12(14), 14897-14917 (2020-07-28)
T-006, a new derivative of tetramethylpyrazine, has been recently found to protect against 6-hydroxydopamine (6-OHDA)-induced neuronal damage and clear α-synuclein (α-syn) by enhancing proteasome activity in an α-syn transgenic Parkinson's disease (PD) model. The effect of T-006 on the 1-methyl-4-phenyl-1
Zhi-Qin Hu et al.
Oncotarget, 8(54), 92079-92089 (2017-12-02)
The role of microRNA-92b-3p (miR-92b-3p) in cardiac hypertrophy was not well illustrated. The present study aimed to investigate the expression and potential target of miR-92b-3p in angiotensin II (Ang-II)-induced mouse cardiac hypertrophy. MiR-92b-3p was markedly decreased in the myocardium of
Jung-Hwa Han et al.
Life sciences, 135, 1-8 (2015-06-03)
bFGF is a potent mitogen of cells associated with fibrosis. Although ERK5 has been reported to play roles in the development of fibrosis, its roles in regulating bFGF-induced fibrotic responses are not understood, especially in lung fibroblasts. The authors investigated
모든 관련된 서류 보기

질문

후기

평점 값 없음

활성 필터

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.