설명
Powered by Eupheria Biotech
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
CGGCAGATGGAGATTCAGAAACATAAGGACAACAAGAAACTTCCCCAAGGTATCATTATAGTCTTTAGACTTCAGACACACACCACACCTCAAATATATACACAACTGAAAGGAAAATTAAGGAAGTTTTTCAAAGAACCCTATTCCGAGTAAGAAGTGTGTTGCATGAATTTCTAAGAGCCAGAAAATGCATGACACAGGAGAAGATGTACCCTCATCTGTTCAGTGAGAGATGTGCAAATCAACATCAACACAGAACTGCTGAAGAAAAAAAATATGTCTCTGAAAAGCAACTTATTCACTGGAGATGTGAGGAGCCATCCGCACATCACAATTCTATAGACATCAAACGCATGAAGCATTTCGGATCTGCTTTAAGACTGAGGCAGACTTTCCATCTGGACACAGCCGACCATCCATGTGTCATTACAATGAATCCAGCACTTCCCTG
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... CASC2(255082)
관련 카테고리
일반 설명
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
가장 최신 버전 중 하나를 선택하세요:
Y X Dai et al.
Journal of biological regulators and homeostatic agents, 34(1), 49-56 (2020-03-07)
Dysregulation of lncRNA cancer susceptibility candidate 2 (CASC2) is involved in the pathogenesis of multiple malignancies. However, the underlying mechanisms by which lncRNA CASC2 regulates the proliferation of hemangiomas (HAs) remain undocumented. Herein, the expression levels of lncRNA CASC2 and
Yufeng Wang et al.
Molecular cancer, 16(1), 123-123 (2017-07-19)
Recently, it has been reported that long non-coding RNA (lncRNA) cancer susceptibility candidate 2 (CASC2), a novel tumor suppressor, participates in regulating the carcinogenesis and suppresses tumor progression by sponging microRNAs (miRNAs). However, the expression and function of CASC2 in
Chenjing Wang et al.
Molecular medicine (Cambridge, Mass.), 26(1), 74-74 (2020-07-24)
Studies have demonstrated that long noncoding RNAs (lncRNAs) have essential impacts on the development of atherosclerosis (AS). This study aimed to identify the role and functional mechanism of lncRNA CASC2 in the development and migration of vascular smooth muscle cells
Qi-Yu Liu et al.
The Kaohsiung journal of medical sciences, 37(4), 268-275 (2020-12-19)
Long noncoding RNA (lncRNA) Cancer Susceptibility 2 (CASC2) has been proved to contribute to the development of cancers. However, the mechanism behind the action of CASC2 in thyroid cancer is not quite clear. We demonstrated that CASC2 was downregulated in
활성 필터
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.
