콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU132491

Sigma-Aldrich

MISSION® esiRNA

targeting human BTK

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

TGGCCATCAAGATGATCAAAGAAGGCTCCATGTCTGAAGATGAATTCATTGAAGAAGCCAAAGTCATGATGAATCTTTCCCATGAGAAGCTGGTGCAGTTGTATGGCGTCTGCACCAAGCAGCGCCCCATCTTCATCATCACTGAGTACATGGCCAATGGCTGCCTCCTGAACTACCTGAGGGAGATGCGCCACCGCTTCCAGACTCAGCAGCTGCTAGAGATGTGCAAGGATGTCTGTGAAGCCATGGAATACCTGGAGTCAAAGCAGTTCCTTCACCGAGACCTGGCAGCTCGAAACTGTTTGGTAAACGATCAAGGAGTTGTTAAAGTATCTGATTTCGGCCTGTCCAGGTATGTCCTGGATGATGAATACACAAGCTCAGTAGGCTCCAAATTTCCAGTCCGGTGGTCCCCACCGGAAGTCCTGATGTATAGCAAGTTCAGCAGCAAATCTGACATTTGGGCTTTTGGGGTTTTGATGTGGGAAATTTACTCCCTGGGGAAGATGCCATATGAGAGATTTACTAACAGTGAGACTGCTGAACACATTGCCCAAGGCCTACGTCTCTACAGGCCTCATCTGGCT

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... BTK(695) , BTK(695)

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Chandra Bose Prabaharan et al.
Investigational new drugs, 38(4), 909-921 (2019-08-04)
Treatment response rates to current anticancer therapies for HER2 overexpressing breast cancer are limited and are associated with severe adverse drug reactions. Tyrosine kinases perform crucial roles in cellular processes by mediating cell signalling cascades. Ibrutinib is a recently approved Tyrosine Kinase
E Slinger et al.
Leukemia, 31(12), 2601-2607 (2017-05-04)
The clinical success of B-cell receptor (BCR) signaling pathway inhibitors in chronic lymphocytic leukemia (CLL) is attributed to inhibition of adhesion in and migration towards the lymph node. Proliferation of CLL cells is restricted to this protective niche, but the
Agnieszka Krupa et al.
American journal of physiology. Lung cellular and molecular physiology, 307(6), L435-L448 (2014-08-03)
Previous observations made by our laboratory indicate that Bruton's tyrosine kinase (Btk) may play an important role in the pathophysiology of local inflammation in acute lung injury (ALI)/acute respiratory distress syndrome (ARDS). We have shown that there is cross talk
Genevra Pillinger et al.
Scientific reports, 5, 12949-12949 (2015-08-22)
Approximately 20% of patients with acute myeloid leukaemia (AML) have a mutation in FMS-like-tyrosine-kinase-3 (FLT3). FLT3 is a trans-membrane receptor with a tyrosine kinase domain which, when activated, initiates a cascade of phosphorylated proteins including the SRC family of kinases.
Angela Marina Montalbano et al.
European journal of pharmacology, 736, 35-43 (2014-05-07)
Cigarette smoke extract (CSE) affects the expression of Choline Acetyl-Transferase (ChAT), muscarinic acetylcholine receptors, and mucin production in bronchial epithelial cells. Mucin 5AC (MUC5AC), muscarinic acetylcholine receptor M3, ChAT expression, acetylcholine levels and acetylcholine binding were measured in a human

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.