콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU131051

Sigma-Aldrich

MISSION® esiRNA

targeting human DDX58

로그인조직 및 계약 가격 보기

크기 선택

20 μG
₩330,484
50 μG
₩589,817

₩330,484

구입 가능 여부는 고객센터에 문의하십시오.
모든 사진(1)

크기 선택

보기 변경
20 μG
₩330,484
50 μG
₩589,817

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

₩330,484

구입 가능 여부는 고객센터에 문의하십시오.

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

ATCTGGAGGAACTGGAGCAAGTTGTTTATAAGCCCCAGAAGTTTTTCAGGAAAGTGGAATCACGGATTAGCGACAAATTTAAATACATCATAGCTCAGCTGATGAGGGACACAGAGAGTCTGGCAAAGAGAATCTGCAAAGACCTCGAAAACTTATCTCAAATTCAAAATAGGGAATTTGGAACACAGAAATATGAACAATGGATTGTTACAGTTCAGAAAGCATGCATGGTGTTCCAGATGCCAGACAAAGATGAAGAGAGCAGGATTTGTAAAGCCCTGTTTTTATACACTTCACATTTGCGGAAATATAATGATGCCCTCATTATCAGTGAGCATGCACGAATGAAAGATGCTCTGGATTACTTGAAAGACTTCTTCAGCAATGTCCGAGCAGCAGGATTCGATGAGATTGAGCAAGATCTTACTCAGAGATTTGAAGAAAAGCTGCAGGAACTAGAAAGTGTTTCCAGGGATCCC

Ensembl | 인체 수납 번호

ENSG00000107201

NCBI 수납 번호

NM_014314

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... DDX58(23586) , DDX58(23586)

관련 카테고리

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number
CRU
TLU
QCS
IRT
UZS

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

COA 검색

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Ting He et al.
Life sciences, 231, 116570-116570 (2019-06-18)
Systemic inflammation is a main hallmark of chronic kidney disease (CKD), but the underlying mechanisms of pathogenesis of CKD-associated systemic inflammation is unclear. Current study was designed to investigate the relationship between indoxyl sulphate (IS) and CKD-associated systemic inflammation along
Darong Yang et al.
PloS one, 9(4), e94501-e94501 (2014-04-15)
The interaction between hepatitis C virus (HCV) and human hepatic innate antiviral responses is unclear. The aim of this study was to examine how human hepatocytes respond to HCV infection. An infectious HCV isolate, JFH1, was used to infect a
Ming Zhong et al.
BMC cancer, 19(1), 439-439 (2019-05-16)
Dendritic cells (DCs) alter their role from being immunostimulatory to immunosuppressive at advanced stages of tumor progression, but the influence of cancer stem cells (CSCs) and their secreted factors on generation and phenotypic change of DCs is unknown. Retinoic acid-inducible
Lei Li et al.
Neuroscience letters, 672, 46-52 (2018-02-24)
The retinoic acid-inducible gene I (RIG-I) is a crucial cytoplasmic pathogen recognition receptor involved in neuroinflammation in degenerative diseases. In the present study, in vitro human astrocytes were subjected to a chemical hypoxia model using cobalt chloride pretreatment. Chemical hypoxia
Joon H Choi et al.
Genes & development, 34(23-24), 1697-1712 (2020-11-14)
Deciphering the mechanisms that regulate the sensitivity of pathogen recognition receptors is imperative to understanding infection and inflammation. Here we demonstrate that the RNA triphosphatase dual-specificity phosphatase 11 (DUSP11) acts on both host and virus-derived 5'-triphosphate RNAs rendering them less
모든 관련된 서류 보기

질문

후기

평점 값 없음

활성 필터

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.