추천 제품
설명
Powered by Eupheria Biotech
제품 라인
MISSION®
형태
lyophilized powder
esiRNA cDNA 표적 서열
CCAAGATGCCAGTTTTTGCTTCTTTGTTAGTTGTCAGCTGCTTTTATCAAATTTCAGGCCATTATCCAACAAACACTATAAAAATGTTTGAACAATTGGATTTCAAACATTTTCGTTTTGTGGAGTGGTGCTCACCAAGTGGTACAGCCCTAAGCAAGTGAACACAAACACATTTAAGTGTATTTTGTCTGATTAGATGTTAGCCAGTTATGCTATTTCATTCAAATGTCTGAAAAAATCAATTGACTATTCCCTTTTCCTAAAGGGCAGAGACAGATAATCTCACTTCCAGAGAAATGACTTGGAGAAAAAAAAGTGTTGGTCTTTTTGCTCTTTTGTAATTAAATCCGGATGTACCTCAAAAGACTTAAGACTGTGGTGATAAGATGCTTTCCTCAGCAGAAAGGAGGGAAAAAAAACAACTGGAACTCAAAGCTTGAAATTCTGTGGCAAAACATGAGATGTCCAGGATTGGAGGTTGAA
Ensembl | 인체 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... TUG1(55000)
일반 설명
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
시험 성적서(COA)
제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.
E Zhang et al.
Cell death & disease, 7, e2109-e2109 (2016-02-26)
Recent evidence highlights long noncoding RNAs (lncRNAs) as crucial regulators of cancer biology that contribute to tumorigenesis. LncRNA TUG1 was initially detected in a genomic screen for genes upregulated in response to taurine treatment in developing mouse retinal cells. Our
Zhi-Qiang Li et al.
Journal of oral pathology & medicine : official publication of the International Association of Oral Pathologists and the American Academy of Oral Pathology, 46(10), 956-960 (2017-06-10)
This study sought to study the expression of the long non-coding RNA (lncRNA) taurine-upregulated gene 1 (TUG1) in tongue squamous cell carcinoma (TSCC) and reveal its possible function. qRT-PCR was used to evaluate 27 samples of fresh TSCC tissues and
Jingjing Li et al.
Oncotarget, 8(39), 65932-65945 (2017-10-17)
Emerging evidence shows that the Hedgehog pathway and the long noncoding RNA TUG1 play pivotal roles in cell proliferation, migration, and invasion in tumors. However, the mechanism underlying the effect of TUG1 and the Hedgehog pathway in hepatoma remains undefined.
Heng Li et al.
Experimental and therapeutic medicine, 16(2), 779-787 (2018-08-18)
Taurine upregulated gene 1 (TUG1), a long non-coding RNA (lncRNA), has recently been suggested to be associated with the development of osteosarcoma (OS), but the underlying molecular mechanism still remains largely unclear. In the present study, it was revealed that
Huijuan Jiang et al.
Radiation oncology (London, England), 12(1), 65-65 (2017-04-06)
Long non-coding RNAs (lncRNAs) have been reported to regulate the sensitivity of different cancer cells to chemoradiotherapy. Aberrant expression of lncRNA Taurine-upregulated gene 1 (TUG1) has been found to be involved in the development of bladder cancer, however, its function
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.