콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU129311

Sigma-Aldrich

MISSION® esiRNA

targeting human ADAM10

로그인조직 및 계약 가격 보기

크기 선택

20 μG
₩330,484
50 μG
₩589,817

₩330,484


구입 가능 여부는 고객센터에 문의하십시오.


크기 선택

보기 변경
20 μG
₩330,484
50 μG
₩589,817

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

₩330,484


구입 가능 여부는 고객센터에 문의하십시오.

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

CCGAACTCTGCCATTTCACTCTGTCATTTATCATGAAGATGATATTAACTATCCCCATAAATACGGTCCTCAGGGGGGCTGTGCAGATCATTCAGTATTTGAAAGAATGAGGAAATACCAGATGACTGGTGTAGAGGAAGTAACACAGATACCTCAAGAAGAACATGCTGCTAATGGTCCAGAACTTCTGAGGAAAAAACGTACAACTTCAGCTGAAAAAAATACTTGTCAGCTTTATATTCAGACTGATCATTTGTTCTTTAAATATTACGGAACACGAGAAGCTGTGATTGCCCAGATATCCAGTCATGTTAAAGCGATTGATACAATTTACCAGACCACAGACTTCTCCGGAATCCGTAACATCAGTTTCATGGTGAAACGCATAAGAATCAATACAACTGCTGATGAGAAGGACCCTACAAATCCTTTCCGTTTCCC

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Zikang Xie et al.
Environmental toxicology, 35(8), 867-878 (2020-03-22)
MiR-20a has been reported as a key regulator to pro-inflammatory factor release in fibroblast-like synoviocytes (FLS), which caused rheumatoid arthritis (RA). However, the molecular mechanism of miR-20a in RA remains to be further elucidated. This study aimed to investigate the
Chuanjin Ding et al.
Oncology reports, 38(2), 866-874 (2017-06-29)
The aim of this study was to determine the effect of A disintegrin and metalloprotease 10 (ADAM10) protein expression on the progression, migration and prognosis of hypopharyngeal squamous cell carcinoma (HSCC). Immunohistochemistry and western blot analysis were performed to detect ADAM10
Jessica Pruessmeyer et al.
Blood, 123(26), 4077-4088 (2014-05-17)
Inflammation is a key process in various diseases, characterized by leukocyte recruitment to the inflammatory site. This study investigates the role of a disintegrin and a metalloproteinase (ADAM) 10 and ADAM17 for leukocyte migration in vitro and in a murine
Jun Lu et al.
Cancer management and research, 12, 9577-9587 (2020-10-17)
Non-small cell lung cancer (NSCLC) remains the most commonly diagnosed malignancy and the leading cause of cancer death worldwide. Circular RNAs (circRNAs) have been demonstrated to play critical roles in human carcinogenesis, including NSCLC. However, it is still unclear whether
Xiufen Liu et al.
Communications biology, 3(1), 728-728 (2020-12-03)
Mesothelin (MSLN) is a lineage restricted cell surface protein expressed in about 30% of human cancers and high MSLN expression is associated with poor survival in several different cancers. The restricted expression of MSLN in normal tissue and its frequent

질문

후기

평점 값 없음

활성 필터

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.