설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
TGGCCACTACAAACAAGCAACTGTGGGCGACATAAATACAGAACGGCCCGGGATGTTGGACTTCACGGGCAAGGCCAAGTGGGATGCCTGGAATGAGCTGAAAGGGACTTCCAAGGAAGATGCCATGAAAGCTTACATCAACAAAGTAGAAGAGCTAAAGAAAAAATACGGGATATGAGAGACTGGATTTGGTTACTGTGCCA
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
일반 설명
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Long-Long Cao et al.
Journal of Alzheimer's disease : JAD, 68(3), 1095-1111 (2019-03-19)
Alzheimer's disease (AD) is reported to be associated with the accumulation of calcium ions (Ca2+), which is responsible for the phosphorylation of tau. Although a series of evidence have demonstrated this phenomenon, the inherent mechanisms remain unknown. Using tauP301S and
Govindasamy-Muralidharan Karthik et al.
Cancer letters, 367(1), 76-87 (2015-07-26)
Breast cancer cells with stem cell characteristics (CSC) are a distinct cell population with phenotypic similarities to mammary stem cells. CSCs are important drivers of tumorigenesis and the metastatic process. Tamoxifen is the most widely used hormonal therapy for estrogen
활성 필터
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.
