콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU127561

Sigma-Aldrich

MISSION® esiRNA

targeting human GDF5

로그인조직 및 계약 가격 보기

크기 선택

20 μG
₩330,484
50 μG
₩589,817

₩330,484


구입 가능 여부는 고객센터에 문의하십시오.


크기 선택

보기 변경
20 μG
₩330,484
50 μG
₩589,817

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

₩330,484


구입 가능 여부는 고객센터에 문의하십시오.

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

CCAGGACGATAAGACCGTGTATGAGTACCTGTTCAGCCAGCGGCGAAAACGGCGGGCCCCACTGGCCACTCGCCAGGGCAAGCGACCCAGCAAGAACCTTAAGGCTCGCTGCAGTCGGAAGGCACTGCATGTCAACTTCAAGGACATGGGCTGGGACGACTGGATCATCGCACCCCTTGAGTACGAGGCTTTCCACTGCGAGGGGCTGTGCGAGTTCCCATTGCGCTCCCACCTGGAGCCCACGAATCATGCAGTCATCCAGACCCTGATGAACTCCATGGACCCCGAGTCCACACCACCCACCTGCTGTGTGCCCACGCGGCTGAGTCCCATCAGCATCCTCTTCATTGACTCTGCCAACAACGTGGTGTATAAGCAGTATGAGGACATGGTCGTGGAGTCGTGTGGCTGCAGGTAGCAGCACTGGCCCTCTGTCTTCCTGGGTGGCACATCCCAAGAGCCCCTTCCTGCACTCCTGGAATCACAGAGGGGTCAGGAAGCTGTGGCAGGAGCATCTACA

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our 문서 section.

도움이 필요하시면 연락하세요. 고객 지원 부서

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Md Fahmid Islam et al.
Scientific reports, 7(1), 1040-1040 (2017-04-23)
Next generation sequencing is becoming the method of choice for functional genomic studies that use pooled shRNA or CRISPR libraries. A key challenge in sequencing these mixed-oligo libraries is that they are highly susceptible to hairpin and/or heteroduplex formation. This
Wei Liu et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 83, 1414-1421 (2016-10-25)
The precise role of interleukin-1 beta (IL-1β)-induced extracellular matrix degeneration in the pathogenesis of intervertebral disc degeneration (IDD) is currently unknown. Recent evidence has revealed that microRNAs (miRNAs) are associated with IDD, but their function in the extracellular matrix degradation
Dagmara M Wiatrek et al.
RNA (New York, N.Y.), 25(6), 713-726 (2019-03-22)
Viral and cellular double-stranded RNA (dsRNA) is recognized by cytosolic innate immune sensors, including RIG-I-like receptors. Some cytoplasmic dsRNA is commonly present in cells, and one source is mitochondrial dsRNA, which results from bidirectional transcription of mitochondrial DNA (mtDNA). Here

질문

후기

평점 값 없음

활성 필터

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.