설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
ACGGAGGTGGGAGAAAATCTGGGCACATGGGGCCCCCTGGGCAGTGCAGGACAACATCAGCTCACTGGCAGGAAAGTCCTTGTTGAGGGTGAGGGGGTGCTGGGGTACCCGGGGGCTGGGGAAGCAAGGAAATAAGTCATCTGTATGCTGACTGGGGATAATGGCATCAAATGTCAGTCCTTGACATTTGGGGGGAACAGCAGGTGCCAGAGCTAAAAGG
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... GYPC(2995) , GYPC(2995)
일반 설명
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Jie Liu et al.
Hepatology (Baltimore, Md.), 69(4), 1535-1548 (2018-12-07)
Endocannabinoids promote energy conservation in obesity, whereas cannabinoid-1 receptor (CB1 R) blockade reverses body weight gain and insulin resistance and increases energy expenditure. Here we investigated the molecular mechanisms of the catabolic effects of CB1 R blockade in the liver.
Weiwei Cheng et al.
Neuron, 104(5), 885-898 (2019-10-08)
Hexanucleotide GGGGCC repeat expansion in C9ORF72 is the most prevalent genetic cause of amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD). One pathogenic mechanism is the aberrant accumulation of dipeptide repeat (DPR) proteins produced by the unconventional translation of expanded RNA repeats.
Charles A Berdan et al.
Cell chemical biology, 26(7), 1027-1035 (2019-05-14)
Parthenolide, a natural product from the feverfew plant and member of the large family of sesquiterpene lactones, exerts multiple biological and therapeutic activities including anti-inflammatory and anti-cancer effects. Here, we further study the parthenolide mechanism of action using activity-based protein
Arif Yurdagul et al.
Cell metabolism, 31(3), 518-533 (2020-02-01)
Continual efferocytic clearance of apoptotic cells (ACs) by macrophages prevents necrosis and promotes injury resolution. How continual efferocytosis is promoted is not clear. Here, we show that the process is optimized by linking the metabolism of engulfed cargo from initial
Florian Beaumatin et al.
Molecular cell, 76(1), 163-176 (2019-09-08)
Sensing nutrient availability is essential for appropriate cellular growth, and mTORC1 is a major regulator of this process. Mechanisms causing mTORC1 activation are, however, complex and diverse. We report here an additional important step in the activation of mTORC1, which
활성 필터
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.
