설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
ATAACTGGGCCTACGGCTTTGGGTGGGCAGCCACGATTATCCTGATTGGCTGTGCCTTCTTCTTCTGCTGCCTCCCCAACTACGAAGATGACCTTCTGGGCAATGCCAAGCCCAGGTACTTCTACACATCTGCCTAACTTGGGAATGAATGTGGGAGAAAATCGCTGCTGCTGAGATGGACTCCAGAAGAAGAAACTGTTTCTCCAGGCGACTTTGAACCCATTTTTTGGCAGTGTTCATATTATTAAACTAGTCAAAAATGCTAAAATAATTTGGGAGAAAATATTTTTTAAGTAGTGTTATAGTTTCATGTTTATCTTTTATTATGTTTTGTGAAGTTGTGTCTTTTCACTAATTACCTATACTATGCCAATATTTCCTTATATCTATCCATAACATTTATACTACATTTGTAAGAGAATATGCACGTGAA
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... PERP(64065) , PERP(64065)
일반 설명
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Yu Zhang et al.
Journal of cellular physiology, 234(7), 11330-11347 (2018-11-28)
Salmonella Enteritidis (SE) can be transmitted to eggs through cecum or the ovary from infected layers and causes food poisoning in humans. The mechanism of cecal transmission has been extensively studied. However, the mechanism and route of transovarian transmission of
Yu Zhang et al.
PeerJ, 7, e7663-e7663 (2019-10-01)
The zoonotic pathogen Salmonella not only reduces the production performance in ducks, but also poses a serious threat to human health through eggs and pollutes water bodies through feces. SipC, an effector protein of type III secretion systems (T3SS) in
활성 필터
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.
