설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
AAAGCAAGGCCCACAGACTACCCCACTCAAGAACAGCAGTTGCATTTTATTCGTCATTACCTGGCAGAGGCAAAGAAAGGTGAGACCCTCTCCCAAGAGGAGCAGAGAAAACTGGAAGAAGATTTGCTGGTAGAAGTCAGTCGGTATGCTCTGGCATCCCATTTCTTCTGGGGTCTGTGGTCCATCCTCCAGGCATCCATGTCCACCATAGAATTTGGTTACTTGGACTATGCCCAGTCTCGGTTCCAGTTCTACTTCCAGCAGAAGGGGCAGCTGACCAGTGTCCACTCCTCATCCTGACTCC
Ensembl | 인체 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... CHKB(1120) , CHKB(1120)
일반 설명
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Xiaoyun Yang et al.
Life sciences, 106(1-2), 12-18 (2014-04-22)
The checkpoint kinase 1 (Chk1) functions not only in genotoxic stresses but also in normal cell cycle progression, particularly in the initiation, progression and fidelity of unperturbed mitosis. In this study, we investigated the role of Chk1 in regulating the
F Ye et al.
Cancer gene therapy, 21(5), 209-217 (2014-05-24)
Mammalian checkpoint kinases 1 and 2 (Chk1 and Chk2) are essential kinases that are involved in cell cycle checkpoint control, and the abrogation of either has been proposed as one way to sensitize cancer cells to DNA-damaging agents. However, it
Hui Ling et al.
Oncology reports, 32(5), 2274-2282 (2014-09-02)
Previous studies have shown that diallyl disulfide (DADS), a naturally occurring anticancer agent in garlic, arrested human gastric cancer cells (MGC803) in the G2/M phase of the cell cycle. Due to the importance of cell cycle redistribution in DADS-mediated anticarcinogenic
활성 필터
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.
