설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
CTGCTGCAAGCTTTCTTCCTGGTGGCAGATGACATCATGGATTCATCCCTTACCCGCCGGGGACAGATCTGCTGGTATCAGAAGCCGGGCGTGGGTTTGGATGCCATCAATGATGCTAACCTCCTGGAAGCATGTATCTACCGCCTGCTGAAGCTCTATTGCCGGGAGCAGCCCTATTACCTGAACCTGATCGAGCTCTTCCTGCAGAGTTCCTATCAGACTGAGATTGGGCAGACCCTGGACCTCCTCACAGCCCCCCAGGGCAATGTGGATCTTGTCAGATTCACTGAAAAGAGGTACAAATCTATTGTCAAGTACAAGACAGCTTTCTACTCCTTCTACCTTCCTATAGCTGCAGCCATGTACATGGCAGGAATTGATGGCGAGAAGGAGCACGCCAATGCCAAGAAGATCCTGCTGGAGATGG
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... FDPS(2224) , FDPS(2224)
일반 설명
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Elena Ciaglia et al.
British journal of pharmacology, 174(14), 2287-2301 (2017-04-19)
N We designed and synthesized i6A derivatives characterized by the introduction of diverse chemical moieties in the N6 position of adenosine and tested for their efficacy in U87 cells and in primary glioma cultures, derived from patients. NMR-based structural analysis
Sholeem Griffin et al.
Biology of reproduction, 99(4), 749-760 (2018-04-25)
Preventing postpartum uterine disease depends on the ability of endometrial cells to tolerate the presence of the bacteria that invade the uterus after parturition. Postpartum uterine disease and endometrial pathology in cattle are most associated with the pathogen Trueperella pyogenes.
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.