콘텐츠로 건너뛰기
Merck
모든 사진(1)

문서

EHU113561

Sigma-Aldrich

MISSION® esiRNA

targeting human NOTCH2

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

GCAGTGTCGAGATGGCTATGAACCCTGTGTAAATGAAGGAATGTGTGTTACCTACCACAATGGCACAGGATACTGCAAATGTCCAGAAGGCTTCTTGGGGGAATATTGTCAACATCGAGACCCCTGTGAGAAGAACCGCTGCCAGAATGGTGGGACTTGTGTGGCCCAGGCCATGCTGGGGAAAGCCACGTGCCGATGTGCCTCAGGGTTTACAGGAGAGGACTGCCAGTACTCAACATCTCATCCATGCTTTGTGTCTCGACCCTGCCTGAATGGCGGCACATGCCATATGCTCAGCCGGGATACCTATGAGTGCACCTGTCAAGTCGGGTTTACAGGTAAGGAGTGCCAATGGACGGATGCCTGCCTGTCTCATCCCTGTGCAAATGGAAGTACCTGTACCACTGTGGCCAACCAGTTCTCCTGCAAATGCCTCACAGGCTTCACAGGGCAGAAATGTGAGA

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Jie Deng et al.
Journal of experimental & clinical cancer research : CR, 38(1), 2-2 (2019-01-05)
Glioblastomas multiforme (GBM) is the most devastating primary intracranial malignancy lacking effective clinical treatments. Notch2 has been established to be a prognostic marker and probably involved in GBM malignant progression. N-acetylcysteine (NAC), a precursor of intracellular glutathione (GSH), has been
Xiaoyuan Wang et al.
Stem cell research & therapy, 9(1), 327-327 (2018-11-25)
Lung cancer stem cells have the ability to self-renew and are resistant to conventional chemotherapy. MicroRNAs (miRNAs) regulate and control the expression and function of many target genes; therefore, miRNA disorders are involved in the pathogenesis of human diseases, such
Mercedes Tomé et al.
Stem cell research, 35, 101390-101390 (2019-02-15)
Notch signalling regulates neural stem cell (NSC) proliferation, differentiation and survival for the correct development and functioning of the central nervous system. Overactive Notch2 signalling has been associated with poor prognosis of aggressive brain tumours, such as glioblastoma multiforme (GBM).
Rulan Bai et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 32(6), 3371-3384 (2018-02-03)
Embryo implantation into the uterine endometrium is required for pregnancy establishment in most mammals. By using global expression analysis, we investigated the molecules that are related to epithelial-mesenchymal transition (EMT) in noninvasive bovine trophoblasts and found that the transcription factor
Renying Miao et al.
Life sciences, 257, 117919-117919 (2020-06-26)
This study is undertaken to investigate the role and molecular mechanisms of miR-18a-5p in regulating pulmonary arterial hypertension (PAH) pathogenesis. Gene expression and protein levels were determined by qRT-PCR and western blot, respectively; Cell counting kti-8 and Transwell migration assays

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.