설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
GTCCCTGGATGTCAACCACTTCGCCCCGGACGAGCTGACGGTCAAGACCAAGGATGGCGTGGTGGAGATCACCGGCAAGCACGAGGAGCGGCAGGACGAGCATGGCTACATCTCCCGGTGCTTCACGCGGAAATACACGCTGCCCCCCGGTGTGGACCCCACCCAAGTTTCCTCCTCCCTGTCCCCTGAGGGCACACTGACCGTGGAGGCCCCCATGCCCAAGCTAGCCACGCAGTCCAACGAGATCACCATCCCAGTCACCTTCGAGTCGCGGGCCCAGCTTGGGGGCCCAGAAGCTGCAAAATCCGATGAGACTGCCGCCAAGTAAAGCCTTAGCCCGGATGCCCACCCCTGCTGCCGCCACTGGCTGTGCCTCCCCCGCCACCTGTGTGTTCTTTTGATACATTTATCTTCTGTTTTTCTCAAATAAAGTTCAAAGCAACCA
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... HSPB1(3315) , HSPB1(3315)
일반 설명
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Eva Hadadi et al.
Scientific reports, 6, 39035-39035 (2016-12-16)
Monocytes play a central role in regulating inflammation in response to infection or injury, and during auto-inflammatory diseases. Human blood contains classical, intermediate and non-classical monocyte subsets that each express characteristic patterns of cell surface CD16 and CD14; each subset
Ah-Mee Park et al.
PloS one, 11(2), e0148998-e0148998 (2016-02-10)
Heat shock protein 27 (HSP27) is a member of the small molecular weight HSP family. Upon treatment with transforming growth factor β1 (TGF-β1), we observed upregulation of HSP27 along with that of α-smooth muscle actin (α-SMA), a marker of myofibroblast
Jong-Rung Tsai et al.
PloS one, 9(3), e91331-e91331 (2014-03-13)
Heat-shock proteins (HSPs) are molecular chaperones that protect proteins from damage. HSP27 expression is associated with cancer transformation and invasion. Ginkgo biloba extract (EGb761), the most widely sold herbal supplement, has antiangiogenic effects and induces tumor apoptosis. Data regarding the
Soo-Yeon Hwang et al.
European journal of medicinal chemistry, 139, 892-900 (2017-09-05)
Heat Shock Protein 27 (HSP27) is a member of small heat shock proteins with a highly-conserved α-crystalline domain. It inhibits aggregation of damaged proteins through a complex structural systems of phosphorylation-dependent oligomerization and self-assembly. It has been demonstrated that HSP27
Hiroaki Inaba et al.
Infection and immunity, 86(4) (2018-01-18)
Porphyromonas gingivalis, a periodontal pathogen, has been implicated as a causative agent of preterm delivery of low-birth-weight infants. We previously reported that P. gingivalis activated cellular DNA damage signaling pathways and ERK1/2 that lead to G1 arrest and apoptosis in
활성 필터
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.
