설명
Powered by Eupheria Biotech
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
GGGATGCTTGAAGATGGAAAGAAATTTGATTCCTCCCGGGACAGAAACAAGCCCTTTAAGTTTATGCTAGGCAAGCAGGAGGTGATCCGAGGCTGGGAAGAAGGGGTTGCCCAGATGAGTGTGGGTCAGAGAGCCAAACTGACTATATCTCCAGATTATGCCTATGGTGCCACTGGGCACCCAGGCATCATCCCACCACATGCCACTCTCGTCTTCGATGTGGAGCTTCTAAAACTGGAATGACAGGAATGGCCTCCTCCCTTAGCTCCCTGTTCTTGGATCTGCCATGGAGGGATCTGGTGCCTCCAGACATGTGCACATGAATCCATATGGAGCTTTTCCTGATGTTCCACTCCACTTTGTATAGACATCTGCCCTGACTGAATGTGTTCTGTCACTCAGCTTTGCTTCCGACACCTCTGTTTC
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... FKBP1A(2280) , FKBP1A(2280)
일반 설명
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Mingyou Xing et al.
Cancer chemotherapy and pharmacology, 84(4), 861-872 (2019-08-21)
FK506-binding protein 12 (FKBP12) is abundant, ubiquitously expressed cytoplasmic protein with multiple functions in cell signaling transduction. Recently, we reported a novel function for FKBP12 in oncoprotein mouse double minute 2 (MDM2) self-ubiquitination and degradation, which greatly enhanced the sensitivity
Zicheng Wang et al.
Journal of cell science, 132(10) (2019-04-28)
Necroptosis is a regulated form of necrotic cell death that is mediated by receptor-interacting serine/threonine-protein kinase 1 (RIPK1), RIPK3 and mixed-lineage kinase domain-like protein (MLKL), which mediates necroptotic signal transduction induced by tumor necrosis factor (TNF). Although many target proteins
Itziar M D Posada et al.
Oncotarget, 8(27), 44550-44566 (2017-06-01)
Currently several combination treatments of mTor- and Ras-pathway inhibitors are being tested in cancer therapy. While multiple feedback loops render these central signaling pathways robust, they complicate drug targeting.Here, we describe a novel H-ras specific feedback, which leads to an
Tanner Stokes et al.
Cell reports, 32(5), 107980-107980 (2020-08-07)
Loading of skeletal muscle changes the tissue phenotype reflecting altered metabolic and functional demands. In humans, heterogeneous adaptation to loading complicates the identification of the underpinning molecular regulators. A within-person differential loading and analysis strategy reduces heterogeneity for changes in
활성 필터
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.
