콘텐츠로 건너뛰기
Merck
모든 사진(2)

주요 문서

EHU106441

Sigma-Aldrich

MISSION® esiRNA

targeting human PTEN

로그인조직 및 계약 가격 보기

크기 선택

20 μG
₩330,484
50 μG
₩589,817

₩330,484


예상 입고일2025년 3월 12일세부사항



크기 선택

보기 변경
20 μG
₩330,484
50 μG
₩589,817

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

₩330,484


예상 입고일2025년 3월 12일세부사항


설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

ACCGCCAAATTTAATTGCAGAGTTGCACAATATCCTTTTGAAGACCATAACCCACCACAGCTAGAACTTATCAAACCCTTTTGTGAAGATCTTGACCAATGGCTAAGTGAAGATGACAATCATGTTGCAGCAATTCACTGTAAAGCTGGAAAGGGACGAACTGGTGTAATGATATGTGCATATTTATTACATCGGGGCAAATTTTTAAAGGCACAAGAGGCCCTAGATTTCTATGGGGAAGTAAGGACCAGAGACAAAAAGGGAGTAACTATTCCCAGTCAGAGGCGCTATGTGTATTATTATAGCTACCTGTTAAAGAATCATCTGGATTATAGACCAGTGGCACTGTTGTTTCACAAGATGATGTTTGAAACTATTCCAATGTTCAGTGGCGGAACTTGCAATCCTCAGTTTGTGGTCTGCCAGCTAAAGGTGAAGATATATTCCTCCAATTCAGGACCCACACGACGGGAAGACAAGTTCATGTACTTTGAGTTCCCTCAGCCGTTACCT

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Hu Gao et al.
Reproduction (Cambridge, England) (2019-11-23)
Sertoli cells are indispensable for normal spermatogenesis and increasing evidence has shown that microRNAs (miRNAs) participate in the regulation of Sertoli cell growth. However, the functions and regulatory mechanisms of miRNAs in Sertoli cells of domestic animals have not been
Lei Dou et al.
Frontiers in oncology, 11, 614035-614035 (2021-03-27)
microRNAs (miRNAs) are of great significance in cancer treatment, which may have a desirable result on the regulation of tumorigenesis, progression, recurrence, and chemo-resistance of ovarian cancer. However, the research on the further potential application of miR-4461 in ovarian cancer
Ye Wang et al.
OncoTargets and therapy, 13, 1909-1919 (2020-03-19)
Berberine (BBR), a traditional Chinese medicine, has been shown effects on inhibiting cancer development. Autophagy-mediated resistance plays an important role in cancer progression; therefore, regulation of autophagy is a novel therapeutic strategy for cancer treatment. However, effects of BBR on
Xiaomei Zou et al.
Frontiers in pharmacology, 11, 880-880 (2020-06-26)
Neuronal insulin resistance is implicated in neurodegenerative diseases. Icariin has been reported to improve insulin resistance in skeletal muscle cells and to restore impaired hypothalamic insulin signaling in the rats with chronic unpredictable mild stress. In addition, icariin can exert
Huachao Shen et al.
Neuropathology : official journal of the Japanese Society of Neuropathology, 40(3), 224-231 (2020-02-11)
Neural stem cell (NSC) transplantation has emerged as a promising approach for the treatment of neurological disorders such as cerebral ischemia. As the majority of newly generated cells from exogenous NSCs fail to integrate into the ischemic brain and establish

문서

Quantitative and qualitative western blotting to validate knockdown by esiRNA.

질문

후기

평점 값 없음

활성 필터

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.