설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
GCCCTTACTACGTGGACCTGAACCAGGACTTGTACGTTCAGGCTGAAATCCTCCATTCTGATGCTGTACTGACCTTGTTTGTGGACACCTGCGTGGCATCACCATACTCCAATGACTTCACGTCTTTGACTTATGATCTAATCCGGAGTGGATGCGTGAGGGATGACACCTACGGACCCTACTCCTCGCCATCTCTTCGCATTGCCCGCTTCCGGTTCAGGGCCTTCCACTTCCTGAACCGCTTCCCCTCCGTGTACCTGCGTTGTAAAATGGTGGTGTGCAGAGCGTATGACCCCTCTTCCCGCTGCTACCGAGGCTGTGTGTTGAG
Ensembl | 인체 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... DMBT1(1755) , DMBT1(1755)
일반 설명
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Chao Liang et al.
Nature communications, 10(1), 4579-4579 (2019-10-09)
Rheumatoid arthritis (RA) is a chronic inflammatory disorder characterized by progressive bone erosion. Leflunomide is originally developed to suppress inflammation via its metabolite A77 1726 to attenuate bone erosion. However, distinctive responsiveness to Leflunomide is observed among RA individuals. Here
S C Chang et al.
Cell death and differentiation, 21(9), 1388-1398 (2014-05-03)
The checkpoint between the life and death of macrophages is crucial for the host's frontline immune defense during acute phase infection. However, the mechanism as to how the immune cell equilibrates between apoptosis and immune response is unclear. Using in
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.