설명
Powered by Eupheria Biotech
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
GCAGCACTTTGACTGCTCTGGAGTAGGGTTGTACAATTTCAAGGAATGTTTGGATTTCCTGCATCTTGTGGATTACTCCTTAGATACCGCATAGATTGCAATATAATGCTGCATGTTCAAGATGAACAGTAGCTCCTAGTAATCATAAAATCCACTCTTTGCACAGTTTGATCTTTACTGAAATATGTTGCCAAAATTTATTTTTGTTGTTGTAGCTCTGGATTTTGTTTTGTTTTGTTTTTTAAGGAAACGATTGACAATACCCTTTAACATCTGTGACTACTAAGGAAACCTATTTCTTTCATAGAGAGAAAAATCTCCAATGCTTTTGAAGACA
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... ATXN1(6310) , ATXN1(6310)
일반 설명
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
A-Ram Kang et al.
Oncotarget, 8(11), 18248-18259 (2017-02-18)
The mutant form of the protein ataxin-1 (ATXN1) causes the neurodegenerative disease spinocerebellar ataxia type-1. Recently, ATXN1 was reported to enhance E-cadherin expression in the breast cancer cell line MCF-7, suggesting a potential association between ATXN1 and cancer development. In
Larissa Nitschke et al.
Genes & development, 34(17-18), 1147-1160 (2020-08-09)
Identifying modifiers of dosage-sensitive genes involved in neurodegenerative disorders is imperative to discover novel genetic risk factors and potential therapeutic entry points. In this study, we focus on Ataxin-1 (ATXN1), a dosage-sensitive gene involved in the neurodegenerative disease spinocerebellar ataxia
Yuka Sugihara et al.
PloS one, 14(5), e0217394-e0217394 (2019-05-29)
Recently, we showed that imidazole dipeptide such as carnosine contained abundantly in chicken breast meat improves brain function in a double-blind randomized controlled trial. However, the underlying molecular mechanisms remain unknown. Here, we investigated whether carnosine activates intestinal epithelial cells
활성 필터
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.
