콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU094041

Sigma-Aldrich

MISSION® esiRNA

targeting human MLXIPL

로그인조직 및 계약 가격 보기

크기 선택

20 μG
₩330,484
50 μG
₩589,817

₩330,484


예상 입고일2025년 3월 26일세부사항



크기 선택

보기 변경
20 μG
₩330,484
50 μG
₩589,817

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

₩330,484


예상 입고일2025년 3월 26일세부사항


설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

GCCTCTCTTCTCTCCCAGGTTTCCCTTCCCCACCGTCCCTCCTGCCCCAGGAGTGTCTCCGCTGCCTGCTCCTGCAGCCTTCCCACCCACCCCACAGTCTGTCCCCAGCCCAGCCCCCACCCCCTTCCCCATAGAGCTTCTACCCTTGGGGTATTCGGAGCCTGCCTTTGGGCCTTGCTTCTCCATGCCCAGAGGCAAGCCCCCCGCCCCATCCCCTAGGGGACAGAAAGCCAGCCCCCCTACCTTAGCCCCTGCCACTGCCAGTCCCCCCACCACTGCGGGGAGCAACAACCCCTGCCTCACACAGCTGCTCACAGCAGCTAAGCCGGAGCAAGCCCTGGAGCCACCACTTGTATCCAGCACCCT

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Susumu Suzuki et al.
Endocrine journal, 67(3), 335-345 (2019-12-10)
Carbohydrate response element binding protein (ChREBP), a glucose responsive transcription factor, mainly regulates expression of genes involved in glucose metabolism and lipogenesis. Recently, ChREBP is speculated to be involved in the onset and progression of diabetic nephropathy (DN). However, there
Nan Chen et al.
Journal of cellular physiology, 236(1), 625-640 (2020-06-26)
Lipid deposition caused by the disorder of renal lipid metabolism is involved in diabetic nephropathy (DN). Carbohydrate response element-binding protein (ChREBP) is a key transcription factor in high glucose-induced cellular fat synthesis. At present, the regulation and mechanism of ChREBP
Can Cai et al.
International journal of molecular medicine, 42(3), 1215-1228 (2018-05-23)
Non‑alcoholic fatty liver disease (NAFLD) is a manifestation of metabolic syndrome in the liver and is closely associated with diabetes; however, its pathogenesis remains to be elucidated. Carbohydrate responsive element binding protein (ChREBP), the hub of glucolipid metabolism, regulates the

질문

후기

평점 값 없음

활성 필터

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.