콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU091731

Sigma-Aldrich

MISSION® esiRNA

targeting human MET

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

CCACATTGACCTCAGTGCTCTAAATCCAGAGCTGGTCCAGGCAGTGCAGCATGTAGTGATTGGGCCCAGTAGCCTGATTGTGCATTTCAATGAAGTCATAGGAAGAGGGCATTTTGGTTGTGTATATCATGGGACTTTGTTGGACAATGATGGCAAGAAAATTCACTGTGCTGTGAAATCCTTGAACAGAATCACTGACATAGGAGAAGTTTCCCAATTTCTGACCGAGGGAATCATCATGAAAGATTTTAGTCATCCCAATGTCCTCTCGCTCCTGGGAATCTGCCTGCGAAGTGAAGGGTCTCCGCTGGTGGTCCTACCATACATGAAACATGGAGATCTTCGAAATTTCATTCGAAATGAGACTCATAATCCAACTGTAAAAGATCTTATTGGCTTTGGTCTTCAAGTAGCCAAAGGCATGA

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Demin Jiao et al.
Journal of cellular and molecular medicine, 22(7), 3526-3536 (2018-04-18)
Hepatocyte growth factor (HGF) overexpression is an important mechanism in acquired epidermal growth factor receptor (EGFR) kinase inhibitor gefitinib resistance in lung cancers with EGFR activating mutations. MiR-1-3p and miR-206 act as suppressors in lung cancer proliferation and metastasis. However
Feng-Jie Lin et al.
Molecules and cells, 43(10), 856-869 (2020-10-30)
To elucidate the mechanism of action of HOXA11-AS in modulating the cisplatin resistance of nasopharyngeal carcinoma (NPC) cells. HOXA11-AS and miR-454-3p expression in NPC tissue and cisplatin-resistant NPC cells were measured via quantitative reverse transcriptase polymerase chain reaction. NPC parental
Qian-Qian Liu et al.
Journal of Zhejiang University. Science. B, 21(10), 779-795 (2020-10-13)
Verticillin A is a diketopiperazine compound which was previously isolated from Amanita flavorubescens Alk (containing parasitic fungi Hypomyces hyalines (Schw.) Tul.). Here, we initially found, by wound healing assay and Transwell assay in vitro, that verticillin A possesses an inhibitory
Jie Zhu et al.
Oncotarget, 8(65), 108665-108675 (2018-01-10)
Tumor necrosis factor-related apoptosis inducing ligand (TRAIL) induces apoptosis in malignant cells, but not in normal cells. As papillary thyroid carcinoma cells broadly expressed TRAIL receptors (death receptor 4 and death receptor 5) on their surface, TRAIL is considered as
J van de Kamp et al.
Journal of tissue engineering and regenerative medicine, 11(11), 2988-2998 (2016-09-20)
Mesenchymal stem cells (MSC) are precursor cells of mesodermal tissue and, because of their trophic phenotype, they are known to play beneficial roles in wound healing. In addition, various tissue engineering strategies are based on MSC/biomaterial constructs. As the isolation

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.