콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU085221

Sigma-Aldrich

MISSION® esiRNA

targeting human SHC1

로그인조직 및 계약 가격 보기

크기 선택

20 μG
₩330,484
50 μG
₩589,817

₩330,484


예상 입고일2025년 3월 31일세부사항



크기 선택

보기 변경
20 μG
₩330,484
50 μG
₩589,817

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

₩330,484


예상 입고일2025년 3월 31일세부사항


설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

GGTGTGGTTCGGACTAAGGATCACCGCTTTGAAAGTGTCAGTCACCTTATCAGCTACCACATGGACAATCACTTGCCCATCATCTCTGCGGGCAGCGAACTGTGTCTACAGCAACCTGTGGAGCGGAAACTGTGATCTGCCCTAGCGCTCTCTTCCAGAAGATGCCCTCCAATCCTTTCCACCCTATTCCCTAACTCTCGGGACCTCGTTTGGGAGTGTTCTGTGGGCTTGGCCTTGTGTCAGAGCTGGGAGTAGCATGGACTCTGGGTTTCATATCCAGCTGAGTGAGAGGGTTTGAGTCAAAAGCCTGGGTGAGAATCCTGCCTCTCCCCAAACATTAATCACCAAAGTATTAATGTACAGAGTGGCCCCTCACCTGGGCCTTTCCTGTGCCAACCTGAT

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Zhecheng Wang et al.
Molecular therapy. Nucleic acids, 21, 751-763 (2020-08-12)
We previously found that inhibition of p66Shc confers protection against hepatic stellate cell (HSC) activation during liver fibrosis. However, the effect of p66Shc on HSC proliferation, as well as the mechanism by which p66Shc is modulated, remains unknown. Here, we
Yukun Zhang et al.
Aging, 12(3), 2049-2069 (2020-02-06)
Hepatic steatosis and oxidative stress are considered to be the sequential steps in the development of non-alcoholic fatty liver disease (NAFLD). We previously found that catalpol, an iridoid glucoside extracted from the root of Romania glutinosa L, protected against diabetes-induced
Hyo Jung Shin et al.
International journal of nanomedicine, 15, 2379-2390 (2020-04-21)
Osteoarthritis (OA) is the most common type of joint disease associated with cartilage breakdown. However, the role played by mitochondrial dysfunction in OA remains inadequately understood. Therefore, we investigated the role played by p66shc during oxidative damage and mitochondrial dysfunction
Shuyu Piao et al.
Biochemical and biophysical research communications, 522(4), 869-875 (2019-12-07)
Inhibition of mitochondrial protein CR6 interacting factor 1 (CRIF1) disturbs mitochondrial function, depolarizes membrane potential, and increases reactive oxygen species (ROS) levels in endothelial cells. Impaired mitochondrial function accompanied by oxidative damage is a major contributor to the initiation of
Nara Shin et al.
Polymers, 12(5) (2020-05-06)
p66shc, a member of the shc adaptor protein family, has been shown to participate in regulation of mitochondrial homeostasis, apoptosis, and autophagosome formation. The present study was performed to investigate whether p66shc siRNA-encapsulated poly(d,l-lactic-co-glycolic acid) nanoparticles (p66shc siRNA-PLGA NPs) can

질문

후기

평점 값 없음

활성 필터

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.