콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU084381

Sigma-Aldrich

MISSION® esiRNA

targeting human KDM5B

로그인조직 및 계약 가격 보기

크기 선택

20 μG
₩330,484
50 μG
₩589,817

₩330,484


구입 가능 여부는 고객센터에 문의하십시오.


크기 선택

보기 변경
20 μG
₩330,484
50 μG
₩589,817

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

₩330,484


구입 가능 여부는 고객센터에 문의하십시오.

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

GGAGCATTATCGCTTGCTTCATCGATATTGTGTGTTTTCCCACGATGAGATGATCTGCAAGATGGCTTCCAAGGCTGATGTATTAGATGTTGTAGTGGCTTCAACTGTTCAGAAAGACATGGCCATTATGATTGAGGATGAGAAAGCTTTAAGAGAAACTGTCCGTAAATTGGGAGTGATTGATTCGGAAAGAATGGATTTTGAGCTGTTGCCAGATGATGAACGTCAGTGTGTAAAATGCAAAACTACATGCTTCATGTCTGCCATCTCCTGTTCTTGTAAACCTGGCCTTCTTGTTTGCCTGCATCATGTAAAAGAATTGTGTTCCTGTCCTCCTTACAAATATAAATTGCGGTATAGGTACACGCTGGATGATCTCTACCCTATGATGAATGCATTGAAGCTTCGAGCAGAATCTTACAACGAATGGGCCTT

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Kuang-Tai Kuo et al.
Clinical epigenetics, 10(1), 107-107 (2018-08-11)
Lung cancer is the leading cause of cancer death worldwide. Recently, epigenetic dysregulation has been known to promote tumor progression and therefore may be a therapeutic target for anticancer therapy. JARID1B, a member of histone demethylases, has been found to
Chun-Shu Lin et al.
Cancer letters, 368(1), 36-45 (2015-07-18)
Oral squamous cell carcinoma (OSCC) is a major cause of human mortality globally and radiotherapy is one of the main treatment modalities, however its therapeutic effect is often limited by radioresistance. JARID1B is an epigenetic factor with reported oncogenic potential

질문

  1. Hi - could you please let me know if esiRNA against KDM5B (human) also targets the mouse transcript? Thank you!

    1 답변
    1. Product EHU084381 has not been tested internally in mouse but the esiRNA cDNA target sequence for EHU084381 has 100% homology against Mus musculus lysine demethylase 5B (Kdm5b), mRNA, NM_152895.2.

      도움이 되었습니까?

후기

평점 값 없음

활성 필터

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.