콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU081321

Sigma-Aldrich

MISSION® esiRNA

targeting human BDNF

로그인조직 및 계약 가격 보기

크기 선택

20 μG
₩330,484
50 μG
₩589,817

₩330,484


예상 입고일2025년 5월 13일세부사항



크기 선택

보기 변경
20 μG
₩330,484
50 μG
₩589,817

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

₩330,484


예상 입고일2025년 5월 13일세부사항


설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

GTATCAGAAAGCCCCAAGCAATTGCTGCATCTTAGTAGGGTGAGGGATAAGCAAAAGAGGATGTTCACCATAACCCAGGAATGAAGATACCATCAGCAAAGAATTTCAATTTGTTCAGTCTTTCATTTAGAGCTAGTCTTTCACAGTACCATCTGAATACCTCTTTGAAAGAAGGAAGACTTTACGTAGTGTAGATTTGTTTTGTGTTGTTTGAAAATATTATCTTTGTAATTATTTTTAATATGTAAGGAATGCTTGGAATATCTGCTGTATGTCAACTTTATGCAGCTTCCTTTTGAGGGACAAATTTAAAACAAACAACCCCCCATCACAAACTTAAAGGATTGCAAGGGCCAGATCTGTTAAGTGGTTTCATAGGAGACACATCCAGCAATTGTGTGGTC

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

관련 카테고리

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Abdelrahman Y Fouda et al.
Molecular neurobiology, 54(1), 661-670 (2016-01-14)
Angiotensin type 1 receptor blockers (ARBs) have been shown to be neuroprotective and neurorestorative in experimental stroke. The mechanisms proposed include anti-inflammatory, antiapoptotic effects, as well as stimulation of endogenous trophic factors leading to angiogenesis and neuroplasticity. We aimed to
So Yoon Ahn et al.
Cell transplantation, 26(1), 145-156 (2016-08-19)
Mesenchymal stem cell (MSC) transplantation protects against neonatal severe intraventricular hemorrhage (IVH)-induced brain injury by a paracrine rather than regenerative mechanism; however, the paracrine factors involved and their roles have not yet been delineated. This study aimed to identify the
Chun-Yan Sun et al.
Oncology reports, 37(5), 2751-2760 (2017-04-14)
Brain-derived neurotrophic factor (BDNF) is expressed in a number of neural and non-neuronal tumors. The present study investigated the effect of endogenous BDNF on the biological behavior of cervix cancer cells using small interfering RNA (siRNA). HeLa, a cervix cancer
Chao Deng et al.
Neurochemical research, 45(2), 268-277 (2019-12-08)
Pramipexole (PPX) is a common drug for the treatment of Parkinson's disease. However, the mechanism allows PPX in the progression of Parkinson's disease remains largely unknown. This study aimed to investigate the role of PPX in 1-Methyl-4-phenylpyridinium (MPP+)-treated neuroblastoma cells
Yu-Pu Liu et al.
Frontiers in neuroscience, 14, 525144-525144 (2020-11-03)
Growing evidence indicates that electroacupuncture (EA) has a definite effect on the treatment of peripheral nerve injury (PNI), but its mechanism is not completely clear. MicroRNAs (miRNAs) are involved in the regulation of a variety of biological processes, and EA

질문

후기

평점 값 없음

활성 필터

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.