추천 제품
설명
Powered by Eupheria Biotech
제품 라인
MISSION®
형태
lyophilized powder
esiRNA cDNA 표적 서열
GGCTTCACAGAGAAGGCTGTGGTTCCCCTGGGCCTCTACACTGGGCAGCTGGCCCTGAACTGGGCATGGCCCCCCATCTTCTTTGGTGCCCGACAAATGGGCTGGGCCTTGGTGGATCTCCTGCTGGTCAGTGGGGCGGCGGCAGCCACTACCGTGGCCTGGTACCAGGTGAGCCCGCTGGCCGCCCGCCTGCTCTACCCCTACCTGGCCTGGCTGGCCTTCACGACCACACTCAACTACTGCGTATGGCGGGACAACCATGGCTGGCGTGGGGGACGGCGGCTGCCAGAGTGAGTGCCCGGCCCACCAGGGACTGCAGCTGCACCAGCAGGTGCCATCACGCTTGTGATGTGGTGGCCGTCACGCTTTCATGACCACTGGGCCTGCTAGTCTGTCAGGGCCTT
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
시험 성적서(COA)
제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.
Shanfei Ge et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 92, 942-951 (2017-06-18)
Growth Factor Receptor-bound 2 (GRB2) plays a crucial role in regulation of cellular function including proliferation and differentiation, and we previously identified GRB2 as promoting HSCs (HSCs) proliferation. However, the underlying mechanisms that are involving in the regulation of GRB2
Vladimir M Milenkovic et al.
International journal of molecular sciences, 20(13) (2019-07-22)
The 18 kDa translocator protein (TSPO) is an evolutionary conserved cholesterol binding protein localized in the outer mitochondrial membrane. It has been implicated in the regulation of various cellular processes including oxidative stress, proliferation, apoptosis, and steroid hormone biosynthesis. Since
Eleonora Da Pozzo et al.
International journal of molecular sciences, 20(18) (2019-09-13)
A key role of the mitochondrial Translocator Protein 18 KDa (TSPO) in neuroinflammation has been recently proposed. However, little is known about TSPO-activated pathways underlying the modulation of reactive microglia. In the present work, the TSPO activation was explored in
Stefanie Bader et al.
Psychoneuroendocrinology, 106, 65-76 (2019-04-08)
The translocator protein 18 kDa (TSPO), initially characterized as peripheral benzodiazepine receptor, is a conserved outer mitochondrial membrane protein, implicated in cholesterol transport thereby affecting steroid hormone biosynthesis, as well as in general mitochondrial function related to bioenergetics, oxidative stress, and
Jing Gong et al.
The Journal of neuroscience : the official journal of the Society for Neuroscience, 39(19), 3752-3769 (2019-02-24)
Parkinson's disease is the second most common neurodegenerative disease, after Alzheimer's disease. Parkinson's disease is a movement disorder with characteristic motor features that arise due to the loss of dopaminergic neurons from the substantia nigra. Although symptomatic treatment by the
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.