설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
GGGCGATCTATTTCCCTGTACTATACTGGAGAGAAAGGTCAAAATCAAGACTATAGAGGTGGAAAGAATAGCACTTGGAGTGGTGAATCAAAAACTCTGGTTTTAAGCAACCTCTCCTACAGTGCAACAGAAGAAACTCTTCAGGAAGTATTTGAGAAAGCAACTTTTATCAAAGTACCCCAGAACCAAAATGGCAAATCTAAAGGGTATGCATTTATAGAGTTTGCTTCATTCGAAGACGCTAAAGAAGCTTTAAATTCCTGTAATAAAAGGGAAATTGAGGGCAGAGCAATCAGGCTGGAGTTGCAAGGACCCAGGGGATCACCTAATGCCAGAAGCCAGCCATCCAAAACTCTGTTTGTCAAAGGCCTGTCTGAGGATACCACTGAAGAGACATTAAAGGAGTCATTTGACGGCTCCGTTCGGGCAAGGATAGTTA
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
애플리케이션
MISSION® esiRNA has been used for transfection of cells to target nucleolin.[1]
생화학적/생리학적 작용
NCL (nucleolin) is ribonucleoprotein, mainly involved in ribosomal biogenesis. Additionally, it is linked with cell differentiation and proliferation, stress-conditioned responses and cellular shuttling. This gene is upregulated in cancer cells. In cancer cells, it is associated with progression and is mainly present on the membrane of cancer cells. On the membrane, it binds to tumor promoting proteins.[2][3]
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Nucleolin antagonist triggers autophagic cell death in human glioblastoma primary cells and decreased in vivo tumor growth in orthotopic brain tumor model.
Benedetti E
Oncotarget, 6, 42091-42091 (2015)
Fengfei Wang et al.
Journal of the American Chemical Society, 141(8), 3613-3622 (2019-01-29)
The aim of this study is to illuminate a novel therapeutic approach by identifying a functional binding target of salinomycin, an emerging anticancer stem cell (CSC) agent, and to help dissect the underlying action mechanisms. By utilizing integrated strategies, we
Zoi Diamantopoulou et al.
Oncotarget, 8(52), 90108-90122 (2017-11-23)
In this study, a novel anticancer reagent based on polyplexes nanoparticles was developed. These nanoparticles are obtained by mixing negatively charged polyelectrolytes with the antitumour cationically-charged pseudopeptide N6L. Using two
Quantitative Cell Cycle Analysis Based on an Endogenous All-in-One Reporter for Cell Tracking and Classification.
Zerjatke T
Cell Reports, 19, 1953-1953 (2017)
Nucleolin-binding by ErbB2 enhances tumorigenicity of ErbB2-positive breast cancer.
Wolfson E
Oncotarget, 7, 65320-65320 (2016)
활성 필터
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.
