콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU079921

Sigma-Aldrich

MISSION® esiRNA

targeting human MCL1

로그인조직 및 계약 가격 보기

크기 선택

20 μG
₩330,484
50 μG
₩589,817

₩330,484


예상 입고일2025년 5월 21일세부사항



크기 선택

보기 변경
20 μG
₩330,484
50 μG
₩589,817

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

₩330,484


예상 입고일2025년 5월 21일세부사항


설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

GTGCTCCCCATTGATTGAAGAGTCACTGTCTGAAAGAAGCAAAGTTCAGTTTCAGCAACAAACAAACTTTGTTTGGGAAGCTATGGAGGAGGACTTTTAGATTTAGTGAAGATGGTAGGGTGGAAAGACTTAATTTCCTTGTTGAGAACAGGAAAGTGGCCAGTAGCCAGGCAAGTCATAGAATTGATTACCCGCCGAATTCATTAATTTACTGTAGTGTTAAGAGAAGCACTAAGAATGCCAGTGACCTGTGTAAAAGTTACAAGTAATAGAACTATGACTGTAAGCCTCAGTACTGTACAAGGGAAGCTTTTCCTCTCTCTAATTAGCTTTCCCAGTATACTTCTTAGAAAGTCCAAGTGTTCAGGACTTTTATACCTGTTATACTTTGGCTTGGTTTCCATG

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Eimear O' Reilly et al.
Scientific reports, 8(1), 15752-15752 (2018-10-27)
Acute myeloid leukaemia (AML) is an aggressive cancer with 50-75% of patients relapsing even after successful chemotherapy. The role of the bone marrow microenvironment (BMM) in protecting AML cells from chemotherapeutics and causing consequent relapse is increasingly recognised. However the
Yuto Yasuda et al.
Cell death & disease, 11(3), 177-177 (2020-03-11)
There have been few advances in the treatment of small-cell lung cancer (SCLC) because of the lack of targets. MCL1, a member of the anti-apoptotic BCL-2 family, may be a treatment target in several cancers, including SCLC. However, whether the
Yuzu Zhao et al.
Cell death & disease, 8(10), e3133-e3133 (2017-10-27)
Demethylzeylasteral is one of the extracts of Tripterygium wilfordii Hook F, which plays important roles in multiple biological processes such as inflammation inhibition, as well as immunosuppression. However, anti-cancer function and the underlying mechanisms of demethylzeylasteral in melanoma cells remain
Takahito Sugase et al.
Cancer research, 77(24), 6975-6986 (2017-10-19)
STAT3 has been implicated recently in radioresistance in cancer. In this study, we investigated the association between STAT3 and radioresistance in esophageal squamous cell carcinoma (ESCC). Strong expression of activated phospho-STAT3 (p-STAT3) was observed in 16/22 ESCC patients with preoperative
Weiguo Zhang et al.
Molecular cancer therapeutics, 13(7), 1848-1859 (2014-04-18)
Aberrant activation of multiple signaling pathways is common in acute myelogenous leukemia (AML) cells, which can be linked to a poor prognosis for patients with this disease. Previous research with mTOR or MEK inhibitors revealed cytostatic, rather than cytotoxic, effects

질문

후기

평점 값 없음

활성 필터

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.