설명
Powered by Eupheria Biotech
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
TCTCTGAGCCAGCATCATTGAAGGAAGCCCGTTGTTTAATATGGCTGCTAGAAGAACACAGAGACAAGTTCCCAGCATTGCATAGTGCTTTAGATGAATTCTTTGATATAATGGACAGCCGCTGTACTGTGTTAAGGAAACAAGATAGTGGTGAAGCACCGTTTAGTTCAACCAAGGTGAAAAACAAAAGCAAGAAAAAGAAGCCAAAGGATTCAAAGCCTATGTTAGTTGGGTCTGGAACAACTTCAGTAACTTCAAATAATGAGATCATCACTTCAAGTGAAGACCATAGCAATCGAAATTCAGATTCTGCAGGCCCATTTGCAGTGCCTGACCATCTTCGGCAAGATGTAGAAGAATTCGAAGCTCTCTATGACCAACACAGTAACGAATATGTTGTCCGCAA
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... TTC3(7267) , TTC3(7267)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Chong Huang et al.
Molecular medicine reports, 16(5), 6269-6275 (2017-08-30)
Smoking is highly associated with cardiovascular diseases. However, the effect of nicotine, a key ingredient in smoking products, on cardiomyocyte apoptosis remains controversial. The present study aims to clarify the role of nicotine on cardiomyocyte cell apoptosis and to investigate
Bo Yang et al.
Stem cell research & therapy, 12(1), 125-125 (2021-02-14)
Stroke serves as a prevalent cerebrovascular disorder with severe cerebral ischemia/reperfusion (CIR) injury, in which neural stem cells (NSCs) play critical roles in the recovery of cerebral function. Circular RNAs (circRNAs) have been widely found to participate in stroke and
활성 필터
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.
