설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
TGCCATGGAGGTACAGACAAAGAAAGTTCGAAAAGTTCCTCCAGGTTTGCCATCTTCAGTCTATGCTCCATCAGCAAGCACTGCCGACTACAATAGGGACTCGCCAGGCTATCCTTCCTCCAAACCAGCAACCAGCACTTTCCCTAGCTCCTTCTTCATGCAAGATGGCCATCACAGCAGTGACCCTTGGAGCTCCTCCAGTGGGATGAATCAGCCTGGCTATGCAGGAATGTTGGGCAACTCTTCTCATATTCCACAGTCCAGCAGCTACTGTAGCCTGCATCCACATGAACGTTTGAGCTATCCATCACACTCCTCAGCAGACATCAATTCCAGTCTTCCTCCGATGTCCACTTTCCATCGTAGTGGTACAAACCATTACAGCACCTCTTCCTGTACGCCTCCTG
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... TCF4(6925) , TCF4(6925)
관련 카테고리
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
J Wang et al.
British journal of cancer, 111(1), 112-124 (2014-05-31)
Invasion and metastasis remain a critical issue in cervical cancer. However, the underlying mechanism of it in cervical cancer remains unclear. The newly discovered protein, TBLR1, plays a crucial role in regulating various key cellular functions. In this study, western
Stephen Gadomski et al.
Cell reports, 31(4), 107572-107572 (2020-04-30)
Investigating mechanisms that regulate endothelial cell (EC) growth and survival is important for understanding EC homeostasis and how ECs maintain stem cell niches. We report here that targeted loss of Id genes in adult ECs results in dilated, leaky sinusoids
Menglan Cheng et al.
Scientific reports, 5, 10752-10752 (2015-07-18)
Dendritic cells (DCs) are sentinels of the immune system and comprise two distinct subsets: conventional DCs (cDCs) and plasmacytoid DCs (pDCs). Human pDCs are distinguished from mouse pDCs phenotypically and functionally. Basic helix-loop-helix protein E2-2 is defined as an essential
활성 필터
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.
